ID: 1148111497

View in Genome Browser
Species Human (GRCh38)
Location 17:45147127-45147149
Sequence CCCTGTTTATGGAGGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148111486_1148111497 18 Left 1148111486 17:45147086-45147108 CCTCAGTGACTGGTATGGAGGGT 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG 0: 1
1: 0
2: 2
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148111497 Original CRISPR CCCTGTTTATGGAGGGCTGG GGG Intergenic
900089955 1:915894-915916 TCCCCTTTCTGGAGGGCTGGGGG - Intergenic
900206569 1:1434270-1434292 CCCTGTGTACTGGGGGCTGGGGG + Intergenic
900265621 1:1755717-1755739 CCCTGGGCACGGAGGGCTGGGGG + Intronic
900521683 1:3108616-3108638 CTCTGCTTTTGGAGGGGTGGAGG + Intronic
900947167 1:5837453-5837475 CCCTGTTTCTAGGGGTCTGGTGG - Intergenic
901163461 1:7198267-7198289 CCCTGCATTTGGAGGCCTGGAGG + Intronic
901358748 1:8676969-8676991 GGCTGTTTAGGGAGGACTGGAGG - Intronic
901921756 1:12541823-12541845 GCCTGTTTTTGGAGGGCCCGTGG - Intergenic
902834467 1:19037758-19037780 CTCTTTGAATGGAGGGCTGGAGG - Intergenic
903275987 1:22222230-22222252 CCCTGGTTATGACGGGGTGGGGG - Intergenic
903968011 1:27101869-27101891 CTCTGCTCATGGAGGGGTGGGGG + Intronic
907298390 1:53470144-53470166 CCCAGTTCCTGGAGGGCTTGGGG + Intergenic
907444355 1:54498554-54498576 CCCTGCTTAAGGAGCTCTGGTGG + Intergenic
911611516 1:99963451-99963473 TCCTGTGTATAGAGGGCTGTAGG + Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913378473 1:118183116-118183138 ACTTGTTTATGGAAGACTGGAGG + Intronic
913717148 1:121547760-121547782 GCCTGTTGAGGGAGGGCAGGGGG - Intergenic
914793850 1:150903254-150903276 CTCTTTTTATTGAGGGGTGGGGG + Intergenic
922020632 1:221700796-221700818 CACTGTTGATGGAGGGTTGGGGG - Intergenic
923084697 1:230694608-230694630 CCCTCTTTGTGGCAGGCTGGGGG - Intergenic
923746092 1:236701471-236701493 CCCTGTGACTGGAGGGCTGTGGG + Intronic
924136896 1:240976613-240976635 TCATGTTTAAGGAGGTCTGGTGG - Intronic
1064300219 10:14116713-14116735 TCCTATTTATGGAGGGCCAGGGG - Intronic
1067472960 10:46549435-46549457 GCCTGTCTGTGGAGGGCCGGAGG - Exonic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068874887 10:61985336-61985358 CCCTCTTTAAAGAGGGATGGTGG + Intronic
1069409752 10:68141068-68141090 CCCTTTTTTTGGGGGGGTGGTGG - Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1071710049 10:88041070-88041092 CCCTGGTTTTGGAGAGGTGGCGG + Intergenic
1071767870 10:88689388-88689410 CTCTGTTTATGGAAGGGTGAAGG + Intergenic
1075614265 10:123880148-123880170 CCCTGTTCAGGGAGGGTGGGTGG - Intronic
1076552197 10:131288524-131288546 CCCTGTTGATAGTGGGGTGGAGG - Intronic
1077392634 11:2307148-2307170 CCCTGTCCCTGCAGGGCTGGAGG + Intronic
1077545088 11:3165622-3165644 CCCTGGCTAGGGTGGGCTGGGGG - Intronic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1078906105 11:15689243-15689265 CCCTGTTCATGGTGGATTGGTGG - Intergenic
1080845068 11:36019816-36019838 CTCTGTGGATGGAGGACTGGAGG + Intronic
1082976812 11:59080821-59080843 CCGTGTTTATGGTGTGCAGGGGG - Intergenic
1083140482 11:60717400-60717422 CCCTGTGGGTGGAGGGCTTGTGG - Intergenic
1083630440 11:64092412-64092434 CCCTGCCTATGGAGGGCTGGTGG + Intronic
1084090915 11:66878964-66878986 ACCTGCTTAGGGTGGGCTGGTGG - Intronic
1085052985 11:73389229-73389251 CCCTCTTGCTGGAGGGCTGCAGG - Intronic
1087276747 11:96168585-96168607 CCCTGTGGATGGAGGGTTGTTGG + Intronic
1088767737 11:113000695-113000717 CCCTGTTCCTGGAAGGCTGATGG + Intronic
1088820658 11:113453923-113453945 TCCTTTTGATGGGGGGCTGGGGG + Intronic
1089125778 11:116175540-116175562 CCCAGTTTATGGAGGACATGAGG + Intergenic
1089607267 11:119648698-119648720 GCCTGTTTAGGGAGGGCTGTGGG + Intronic
1101343743 12:103865927-103865949 TGGTGTTTTTGGAGGGCTGGTGG - Intergenic
1102221878 12:111200500-111200522 CACTGTTTGTGGAGTGCTGGGGG + Intronic
1102819735 12:115897475-115897497 CCCTGATTCTGGAGGCCAGGTGG + Intergenic
1103063338 12:117876296-117876318 CCCTGCTGAGGGAGGGCTGGAGG + Intronic
1103073995 12:117967957-117967979 TTCTGTTTATTGGGGGCTGGGGG - Intronic
1104608185 12:130205123-130205145 CTAAGTTTATGGAGGGCGGGAGG + Intergenic
1110011798 13:70345313-70345335 CCCTGGTTTTGGGGGGGTGGGGG - Intergenic
1113743637 13:112727700-112727722 CCCGTTTTCTTGAGGGCTGGTGG + Intronic
1115499020 14:34033189-34033211 CCTTGTGGATGGAAGGCTGGGGG - Intronic
1120103248 14:80467691-80467713 CTTGGGTTATGGAGGGCTGGGGG - Intergenic
1120532073 14:85643789-85643811 CCCTGTTTAAGTGGGGTTGGTGG + Exonic
1121448995 14:93996104-93996126 CCCAGTTCAAGGAGGGGTGGGGG - Intergenic
1121712987 14:96053007-96053029 CCCGGTTTCTGCAGGGCTGAGGG + Intronic
1122076276 14:99237049-99237071 CCCTTTTTTTGGGGGGCTGTGGG + Intronic
1122354867 14:101116845-101116867 CCCTGCTCCTGGAGGGCAGGTGG - Intergenic
1123139197 14:106058780-106058802 CCCAGATAAAGGAGGGCTGGGGG + Intergenic
1123582100 15:21725047-21725069 CACTGTTCTTGGGGGGCTGGAGG + Intergenic
1125809430 15:42524961-42524983 GCGTGTTTATGAAGGGGTGGTGG - Intronic
1126792581 15:52234642-52234664 CCCTGTCTCTGTAGGGCTGATGG - Intronic
1129728329 15:77915418-77915440 CCCAGTTCCTGGGGGGCTGGGGG + Intergenic
1132463495 16:67054-67076 CCCTGTGGAGGGAGGGCTGGGGG - Intronic
1132510444 16:338324-338346 AGCTGTTTCTGGAGGGCTTGGGG - Intronic
1136419921 16:30125422-30125444 CCCTTTTTTTGGGGGGGTGGGGG - Intergenic
1138098869 16:54235543-54235565 CCCTCTTTCTGCAGGGCTGCAGG - Intergenic
1141169328 16:81681144-81681166 CCCATTTTGTGGAGGGCTTGGGG - Intronic
1141506471 16:84481600-84481622 CCCTGTTTCTGCAGAGCTGAGGG - Intronic
1142249451 16:88984446-88984468 CCCTGGCTCTGGAGGGCGGGCGG - Intergenic
1144715417 17:17431941-17431963 CCCAGTTTATGGAGAGCGTGTGG + Intergenic
1144726333 17:17504419-17504441 CCCTCTCCTTGGAGGGCTGGAGG - Intergenic
1146373391 17:32279341-32279363 CCCTGCCTGAGGAGGGCTGGGGG + Intronic
1147653758 17:42076858-42076880 TCCTGGTAATGGAGAGCTGGGGG + Intergenic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1149655964 17:58309724-58309746 CGCTGTATCTGGTGGGCTGGAGG + Intronic
1151927079 17:77205891-77205913 CCCTGTTGATGGCAGGTTGGGGG + Intronic
1152060996 17:78075017-78075039 CCCTGTGTTTGAAGGGGTGGAGG + Intronic
1152546240 17:81001368-81001390 TCCTGGTTATGTCGGGCTGGTGG + Intronic
1152716784 17:81904079-81904101 CCCAGGCTTTGGAGGGCTGGAGG + Intronic
1152742448 17:82024257-82024279 CCCTGTGTAAGGGGGGCCGGCGG - Exonic
1153535837 18:6100785-6100807 CCCTGTTAATGTTGGGCTGCAGG + Intronic
1156290718 18:35747132-35747154 CCCTGTGTCAGCAGGGCTGGTGG + Intergenic
1156963530 18:43062005-43062027 TCCTGTTTTTGGTGGGCTAGAGG - Intronic
1157521722 18:48349933-48349955 CCCTGTTTATGAAGGGCAGGTGG - Intronic
1157773731 18:50374204-50374226 ACTTGTTTGTGGAGGTCTGGGGG - Intergenic
1157858538 18:51121757-51121779 CCCTGTTACTGAAAGGCTGGGGG + Intergenic
1159107915 18:64025310-64025332 ACCTGATTTTGGAGGGTTGGGGG - Intergenic
1160944131 19:1633320-1633342 CCCTACTTTTGCAGGGCTGGGGG + Intronic
1161303751 19:3555994-3556016 CCCTGATTAGAGAGGGCTGTTGG - Intronic
1162393584 19:10403910-10403932 CCCCGTTTACGAAGGGCAGGGGG - Intronic
1163283373 19:16330884-16330906 CCCTGTTTCTGGGTGGGTGGGGG + Intergenic
1163666057 19:18604611-18604633 CATTGTTTGTGGAGGCCTGGAGG - Intronic
1165008940 19:32829129-32829151 CCCTGTTGGTGGAGCTCTGGGGG + Intronic
1166976382 19:46607397-46607419 ATCTGTTTTTGGAGGGCTTGGGG + Intronic
1167517033 19:49929458-49929480 CCCTCTTTAGGGAGCCCTGGGGG + Exonic
925299150 2:2797890-2797912 CCCTGGTTATGGACTGCTGGAGG - Intergenic
925975129 2:9137099-9137121 CCCTGTGAACGGAGGGCTGGAGG + Intergenic
926034977 2:9629634-9629656 TCCTGTTTATGGGGGGTGGGGGG + Intronic
926954261 2:18276933-18276955 CCCTGTTGATGGACTGCTGCAGG + Intronic
928472620 2:31589547-31589569 GCCTCTCTAGGGAGGGCTGGAGG + Intergenic
932712607 2:74079040-74079062 CCAAGTTTCTGAAGGGCTGGCGG - Intronic
933942979 2:87260515-87260537 TCCTGTTCAGGGAGGGCTGAGGG + Intergenic
935249118 2:101246160-101246182 ACTTGTTTGTGGAGGACTGGGGG + Intronic
936337234 2:111601047-111601069 TCCTGTTCAGGGAGGGCTGAGGG - Intergenic
942051740 2:172146827-172146849 CACTGTTCAGGCAGGGCTGGGGG + Intergenic
942453846 2:176124551-176124573 CCCTGTTTGGGCAGTGCTGGGGG - Exonic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
945435171 2:209809812-209809834 CCATGTCTGTGGATGGCTGGCGG + Intronic
945683895 2:212946053-212946075 TGATGTTTTTGGAGGGCTGGGGG - Intergenic
946143016 2:217707382-217707404 CCCTGTTCCTGGAGGGCTTTTGG - Intronic
946315147 2:218906488-218906510 CCCAGTGTCTGGTGGGCTGGGGG + Intergenic
946962271 2:224997645-224997667 ACCTGCTGATGGAGGGCGGGAGG + Intronic
948307244 2:236957418-236957440 CCCTGCACATGCAGGGCTGGGGG - Intergenic
1172038306 20:32025955-32025977 CCCTGTTTGTGCAGGGGTAGGGG - Intronic
1172130594 20:32652376-32652398 CCCTTTGCATGGAGGGCTGCTGG - Intergenic
1172794128 20:37525455-37525477 CCCTGCTGATGGACGGATGGAGG - Intronic
1173605390 20:44327409-44327431 GCCAGTTTTTGCAGGGCTGGAGG - Intergenic
1173666943 20:44769751-44769773 CCCAGTTTAGGAGGGGCTGGGGG + Intronic
1175704136 20:61163211-61163233 TCCTGCTTGTGGAGGGCTTGGGG - Intergenic
1175722931 20:61298254-61298276 CCCTGATGATGCAGAGCTGGTGG - Intronic
1176653006 21:9566874-9566896 CCCTGATTATTAGGGGCTGGAGG + Intergenic
1178353889 21:31894525-31894547 CCCTTTTTATGCAGAGCTGCTGG + Intronic
1179191292 21:39124346-39124368 ACCTGTTTCTGGTGGGATGGTGG - Intergenic
1179644237 21:42765916-42765938 TCCTGGTTATGGAGGGGTGCTGG - Intronic
1180176474 21:46092875-46092897 TCCTGTTTATGGAGAGATGGTGG - Intergenic
1180741583 22:18056914-18056936 CCCTGTGATGGGAGGGCTGGAGG - Intergenic
1181976490 22:26734444-26734466 TTATTTTTATGGAGGGCTGGAGG + Intergenic
1183360792 22:37382239-37382261 CCCTGTTACTGGAGGTCTGCAGG - Intronic
1184414159 22:44342456-44342478 CCTTGCTCATGGTGGGCTGGTGG - Intergenic
1184485283 22:44774819-44774841 GCCTTTTTTTGGAGGGGTGGGGG + Intronic
1185288828 22:50014180-50014202 CCTGGTATAAGGAGGGCTGGAGG - Intergenic
949792572 3:7809346-7809368 CCATTATTAAGGAGGGCTGGAGG + Intergenic
950039600 3:9911422-9911444 CCCTGTTTGGGGCGGGGTGGGGG - Exonic
953752802 3:45622212-45622234 TCCTGTTTACCCAGGGCTGGAGG - Intronic
954463466 3:50640800-50640822 CCCTGAATATGGATGGATGGGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958041280 3:88229834-88229856 TTCTGTTTATCGAGGGATGGAGG + Intergenic
961353861 3:126321627-126321649 CCCTGTGCATGGTGGGATGGTGG + Intergenic
963093150 3:141505623-141505645 ACCTGATCATGGAGGGATGGAGG + Intronic
965162523 3:165152588-165152610 GCCTGTTGAGGGAGGGCAGGGGG - Intergenic
967069056 3:185946271-185946293 TCCTATTTATGGAGACCTGGAGG + Intergenic
968594250 4:1474166-1474188 CCCTGGTGATGGAGGGGTGAGGG + Intergenic
969472747 4:7399272-7399294 CCCTGTGGATGGAAGGCTGGCGG + Intronic
970498567 4:16653286-16653308 ACCTGCTTGTGCAGGGCTGGCGG - Intronic
971328524 4:25663739-25663761 CTCAATTTATGGAGGGCTTGGGG - Intronic
977147069 4:93456927-93456949 CCCTGGATATGGAAGGGTGGAGG - Intronic
977243595 4:94603478-94603500 CCCAGTTTGCGGAGGGTTGGGGG - Intronic
978024041 4:103849649-103849671 CCCAGTTTATTGAGTACTGGGGG - Intergenic
978890976 4:113827193-113827215 CACTGTATATGGATGGCTGCTGG + Intergenic
979559749 4:122088760-122088782 ACCAGTTTTTGGAGGGCAGGGGG - Intergenic
983733088 4:171022422-171022444 GCCTGTTTGTGGGGTGCTGGGGG + Intergenic
985828150 5:2207946-2207968 CCCTGTGGATGGGCGGCTGGAGG + Intergenic
986631900 5:9782160-9782182 CCCTGTGCATGGACTGCTGGAGG - Intergenic
987975166 5:25006060-25006082 CTCTGCTTGTGGAGGGCTTGAGG + Intergenic
989603958 5:43226298-43226320 CCCTGTTAAAGGTGGGCAGGAGG + Intronic
990612051 5:57467559-57467581 ACCTGATTATGGAGTGCTGCTGG + Intergenic
995210338 5:109530616-109530638 GGCTGTCTGTGGAGGGCTGGAGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
997376902 5:133403810-133403832 GCCAGTTCATGGGGGGCTGGGGG + Intronic
1001902920 5:175445768-175445790 TCCTGCCTATGGAGGGCTGACGG - Intergenic
1002721188 5:181262082-181262104 CCCTGGGGAGGGAGGGCTGGGGG + Intergenic
1005470681 6:26159412-26159434 CCCTGAGTACGGAGGACTGGAGG + Intronic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006164906 6:32058344-32058366 GCCTGGTTCTGTAGGGCTGGGGG + Intronic
1006842416 6:37037775-37037797 CCCATTTTTTGGAGGGGTGGAGG + Intergenic
1007109194 6:39303384-39303406 GCCTGATTATGCAAGGCTGGTGG + Intronic
1007658714 6:43469120-43469142 CCCTGTTTATTGGGGGCATGTGG - Intergenic
1008439057 6:51511530-51511552 GACTGTTTATGGTAGGCTGGGGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1010454092 6:76035116-76035138 CCCAGTTTGTGGAGTGCTAGGGG + Intronic
1012100435 6:95078243-95078265 ACGTGTTTATGGAGTCCTGGGGG - Intergenic
1013428119 6:110033333-110033355 CCCTGGTCAGGGAGGCCTGGGGG - Intergenic
1015149762 6:130023741-130023763 CCAGCTTTATGAAGGGCTGGAGG + Intronic
1016246267 6:141984871-141984893 CCCTGTTTAGGGAGATCTTGGGG - Intergenic
1016841919 6:148533509-148533531 CCCTGGTTCTGCAGGGCAGGAGG + Intronic
1019210754 6:170402629-170402651 TCCTTTTTCTGGAGGGCTGTGGG - Intronic
1023314429 7:38920736-38920758 CCTTGTATGTGGTGGGCTGGGGG - Intronic
1024802903 7:53101415-53101437 CCGTGTATATGGGGGGCGGGGGG + Intergenic
1025095365 7:56092015-56092037 TTCTGCTCATGGAGGGCTGGGGG - Intronic
1025796841 7:64746000-64746022 ACTTGTTTGTGGAGGCCTGGGGG + Intergenic
1026115570 7:67493021-67493043 CCCTGATAATGTACGGCTGGAGG - Intergenic
1026172841 7:67969581-67969603 CCATGTTTATGGAGTGGTGCTGG - Intergenic
1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG + Intronic
1031495330 7:122440213-122440235 ACCTGTCAATGGAGGGCAGGAGG + Intronic
1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG + Intronic
1035440226 7:158891149-158891171 ACCTGTTTGCTGAGGGCTGGCGG + Intronic
1036214329 8:6866513-6866535 ACTTGTCTATGGAGGCCTGGGGG + Intergenic
1036541320 8:9715022-9715044 CCATGTTTATAGAGCGGTGGTGG + Intronic
1037865145 8:22437413-22437435 GCCTGTTTCTTGAGGGCTGGTGG - Intergenic
1038160457 8:25032142-25032164 GCATTATTATGGAGGGCTGGTGG - Intergenic
1038659500 8:29484769-29484791 GCCTGTTATTGGAGGGGTGGTGG - Intergenic
1040029805 8:42814051-42814073 CACAGTATGTGGAGGGCTGGGGG + Intergenic
1042744848 8:72096747-72096769 ACTTGTTTGTGGAGGCCTGGGGG + Intronic
1042913604 8:73852096-73852118 GTCTGTTTATGAAGGGTTGGAGG + Intronic
1043068934 8:75613414-75613436 CCCTGATTATTGAAGACTGGAGG + Intergenic
1044853787 8:96454080-96454102 CCCCATTTATTGAGGGATGGAGG - Intergenic
1046616373 8:116482044-116482066 TCCTGTATGTGGAGGGGTGGAGG - Intergenic
1047773402 8:128049135-128049157 CCCTGCACATGGAGGCCTGGCGG - Intergenic
1048107018 8:131422051-131422073 TCTTGTTTAGGGAGGACTGGTGG - Intergenic
1048860302 8:138719894-138719916 CCCTGTGGGTGGAGGGCGGGAGG + Intronic
1049338250 8:142097951-142097973 CCCTGATTCTGTGGGGCTGGAGG - Intergenic
1049678918 8:143907004-143907026 TTCTGTTTATTGAGTGCTGGGGG + Intergenic
1049997900 9:1048559-1048581 CCCTGTTACAGGAGGGCTGCTGG + Intergenic
1050028113 9:1356787-1356809 CACTGTGACTGGAGGGCTGGGGG - Intergenic
1050722397 9:8605598-8605620 CCCTATTTATGTAGAGATGGAGG - Intronic
1051055568 9:12981009-12981031 CCATGTTTATGGAGGGTGGAGGG - Intergenic
1051819606 9:21149481-21149503 CCCTGGTTGGGGAGGGCTGTGGG + Intergenic
1052852294 9:33385580-33385602 CCCTGTGTGTTGAGGGGTGGGGG - Intronic
1053839982 9:42182838-42182860 ACCTGTCGAGGGAGGGCTGGTGG + Intergenic
1056031697 9:82560233-82560255 CTCAGTTTAAGGAGGGCTGCTGG - Intergenic
1056104441 9:83332999-83333021 ACCTGTGTATGAAGGGGTGGTGG + Intronic
1058704591 9:107627927-107627949 CCCTGCTGAGGGAGGGCAGGAGG + Intergenic
1060149228 9:121277043-121277065 CCCATATTATGGAGGGGTGGGGG - Intronic
1060430292 9:123545412-123545434 CACAGTTGATGGAGGGATGGTGG - Intronic
1062340184 9:136090666-136090688 GCCTGACTATGGAGGGCTGGGGG + Intronic
1062373984 9:136253803-136253825 CCCTGTGGATGGAGGACGGGAGG + Intergenic
1203791469 EBV:153994-154016 CGCTGTTTATCGAGTGCCGGGGG - Intergenic
1203564489 Un_KI270744v1:80061-80083 CCTTGTTAATGGATGCCTGGTGG + Intergenic
1203630735 Un_KI270750v1:70415-70437 CCCTGATTATTAGGGGCTGGAGG + Intergenic
1186188279 X:7043010-7043032 CACTGTTTATGGAGGGTGGCCGG - Intergenic
1188053649 X:25516590-25516612 CCCTGTAGATGGAGGAATGGAGG + Intergenic
1196111791 X:111954350-111954372 CCCTGCTCATTGAAGGCTGGAGG + Intronic
1198130010 X:133684332-133684354 CTCTGCTTATGAAAGGCTGGTGG - Intronic
1199756595 X:150870697-150870719 CCCTGTTAAAGGAGGGGTGTAGG - Intronic
1199814868 X:151388334-151388356 CCTTGTTCCTGGAGGGCAGGGGG + Intergenic
1200049854 X:153422983-153423005 CCCTGTTTCTGCAGGGCTAAGGG - Intergenic
1200128208 X:153828114-153828136 CCGTGTTTAAGGAGGCCGGGAGG + Intronic
1200375273 X:155773962-155773984 GCCTGTTTACAGGGGGCTGGAGG - Exonic