ID: 1148114885

View in Genome Browser
Species Human (GRCh38)
Location 17:45169755-45169777
Sequence GAACCAGATGTGGAACCGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148114883_1148114885 -5 Left 1148114883 17:45169737-45169759 CCAGCGGCTTCGTCAGGAGAACC 0: 1
1: 0
2: 0
3: 2
4: 186
Right 1148114885 17:45169755-45169777 GAACCAGATGTGGAACCGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 82
1148114881_1148114885 2 Left 1148114881 17:45169730-45169752 CCGAAAACCAGCGGCTTCGTCAG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1148114885 17:45169755-45169777 GAACCAGATGTGGAACCGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 82
1148114878_1148114885 16 Left 1148114878 17:45169716-45169738 CCAGAGGCTCCGGACCGAAAACC 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1148114885 17:45169755-45169777 GAACCAGATGTGGAACCGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 82
1148114877_1148114885 23 Left 1148114877 17:45169709-45169731 CCGAGGTCCAGAGGCTCCGGACC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1148114885 17:45169755-45169777 GAACCAGATGTGGAACCGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 82
1148114880_1148114885 7 Left 1148114880 17:45169725-45169747 CCGGACCGAAAACCAGCGGCTTC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1148114885 17:45169755-45169777 GAACCAGATGTGGAACCGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148114885 Original CRISPR GAACCAGATGTGGAACCGAG AGG Exonic
904486083 1:30825201-30825223 GAGCCAGATGAGGAACGGTGGGG + Intergenic
905990605 1:42334739-42334761 GAACCAGACGTGGATCCCGGGGG - Intronic
909938509 1:81582937-81582959 GAATCAGATGTGGGAGAGAGTGG - Intronic
911233400 1:95384057-95384079 GATCCAGATTTGGAACAGACAGG + Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
919606384 1:199689469-199689491 GAAGCAGAAGTGGGAGCGAGGGG - Intergenic
921682489 1:218050952-218050974 GAACCCAAAGTGGAACAGAGTGG + Intergenic
1065725142 10:28661782-28661804 GAACCAGGTATGGACCCCAGGGG + Intergenic
1081018144 11:37908085-37908107 GAACCGGCTGTGGTACCCAGTGG - Intergenic
1081346195 11:41989450-41989472 GAACCAGAGATGGAACCCTGGGG - Intergenic
1081534770 11:43988683-43988705 AAACCCTGTGTGGAACCGAGTGG - Intergenic
1081574753 11:44311922-44311944 AAACCAGATGTGGGATCGCGCGG - Intergenic
1083414765 11:62518317-62518339 GCACCAGATGTGACACTGAGGGG - Exonic
1083489569 11:63005999-63006021 GAACCAGATGTGGAGCAAATGGG + Intronic
1084958676 11:72704627-72704649 GCTCCAGATGTGGAACTGGGTGG - Intronic
1090598767 11:128347676-128347698 GAAACAGAGGTGGAGCCAAGAGG + Intergenic
1091030324 11:132181266-132181288 GATTCAAATGTGGAACCCAGAGG - Intronic
1096591109 12:52659765-52659787 GAAGCAGAGGTGGAAACTAGAGG - Intergenic
1097023763 12:56038890-56038912 GAACCAGAATTTGAACCCAGGGG + Intergenic
1100467515 12:94859956-94859978 GAATCAGTTGTGGAAGTGAGTGG - Intergenic
1100785747 12:98076137-98076159 GAACCAGATGTTAAACAGAAGGG - Intergenic
1103173817 12:118844482-118844504 GAACCAGATGTGGAACTGCGAGG - Intergenic
1104685726 12:130782835-130782857 GAGCCTGAGGTGGAACTGAGGGG - Intergenic
1111640975 13:90969362-90969384 GTACCAAATGTGTAACAGAGAGG - Intergenic
1118389345 14:65283109-65283131 GAAGCAGATGAAGAACAGAGTGG + Intergenic
1123541210 15:21293759-21293781 GAAACAGATGTGGAAAAAAGGGG - Intergenic
1127133832 15:55897853-55897875 GAACCGGATGTGGAAGCCTGGGG - Intronic
1127549744 15:60025190-60025212 GAACCAGATTTGGAACAGAAGGG - Intronic
1131054218 15:89366039-89366061 GAACCAGCAGAGGAACAGAGAGG - Intergenic
1202949523 15_KI270727v1_random:20900-20922 GAAACAGATGTGGAAAAAAGGGG - Intergenic
1136065944 16:27758632-27758654 GACCCATAGGTGGAACCAAGCGG - Intronic
1142157141 16:88537733-88537755 GAACCAGCTGGGGGGCCGAGGGG - Intergenic
1142415401 16:89938516-89938538 AAAGCAGATGTGGACCTGAGGGG - Intergenic
1148114885 17:45169755-45169777 GAACCAGATGTGGAACCGAGAGG + Exonic
1148671510 17:49414194-49414216 GAACCAGAATTAGAACCCAGAGG + Intronic
1150139592 17:62716927-62716949 GAGCCAGGTTTGGAAGCGAGGGG + Intronic
1155172144 18:23274768-23274790 GAATCAGATGTGAGACTGAGAGG - Intronic
1166196257 19:41207663-41207685 GGACCAGATGTGGAGCTGGGAGG + Intergenic
1167000883 19:46745558-46745580 GGTCCAGATGGGGAACCGGGAGG - Intronic
929423216 2:41816242-41816264 GAACCAGATGGGGAAGGGTGTGG + Intergenic
929859901 2:45667828-45667850 CCACCAGATATGGAACCAAGTGG + Intronic
931091842 2:58894553-58894575 GAATTAGATGTGGAATGGAGTGG + Intergenic
932703259 2:74004792-74004814 GAAGCAGAGGTGGAACCTGGGGG - Intronic
935879220 2:107544451-107544473 GAAGCGGATGTGAAACTGAGTGG + Intergenic
935879248 2:107544647-107544669 GAGCCGGATGTGAAACTGAGGGG + Intergenic
935879293 2:107544941-107544963 GAGCCGGATGTGAAACTGAGTGG + Intergenic
937239040 2:120448452-120448474 GAGCCAGATTAAGAACCGAGAGG - Intergenic
941932240 2:170953741-170953763 GAACCAGATGTAGAAAGGACAGG + Intronic
942924427 2:181414964-181414986 GAACCAGACTTGCATCCGAGGGG - Intergenic
943229326 2:185226573-185226595 GATCCAGATGTTTAACAGAGAGG + Intergenic
946144196 2:217716479-217716501 GAACCAGATGTGGAGGGAAGTGG + Intronic
948686040 2:239670272-239670294 GAGCCGGATGTGGAACTGGGCGG + Intergenic
1172022424 20:31924082-31924104 GAACCAGATGTGGAAGGGGAAGG - Intronic
1172091739 20:32437587-32437609 GAGCCTGATGTGGCACGGAGTGG + Exonic
1173144436 20:40512462-40512484 GAACCATATGATGAACCCAGAGG + Intergenic
1173935379 20:46857588-46857610 GAGCCAGATGTGGAAAGGTGAGG + Intergenic
1180245512 21:46544799-46544821 GCACCCCATGTGGACCCGAGAGG + Intronic
1181999913 22:26911732-26911754 AAACCAGCTGTGGAACCCAGGGG + Intergenic
1184099668 22:42335483-42335505 GCACCAGATGTGGTACTGATTGG - Intronic
1184870887 22:47237883-47237905 GACCCAGGTGGGGAACCGGGTGG + Intergenic
950207738 3:11093403-11093425 GAGCCAGGTGTGGAACGGTGAGG - Intergenic
952964444 3:38612359-38612381 GCACCTGATGTGGAACCTGGTGG - Intronic
953118913 3:40020138-40020160 GTACTAGATGTGGAAGAGAGAGG - Intronic
956781304 3:72605518-72605540 GAACGAGAGGTGGAACAGAAGGG + Intergenic
958449660 3:94258271-94258293 GAAAGAGATGTTGAACCCAGTGG + Intergenic
968451194 4:676793-676815 TGACCAGATGTGGAACCCTGGGG - Intronic
981474223 4:145172099-145172121 CAACCTGTTGTGGAACTGAGTGG + Intronic
988581011 5:32468851-32468873 GAAACAGAGGTAGAACCTAGAGG + Intergenic
991163450 5:63532832-63532854 GAACCTGATGTGGCTCCCAGAGG - Intergenic
1002101559 5:176860485-176860507 GACCCAGACGTGGGACCCAGGGG - Intronic
1006740144 6:36302223-36302245 GAACCAGGTGTGGAGCTGGGTGG - Exonic
1011657210 6:89562862-89562884 GAACACGATGTAGAACAGAGAGG + Exonic
1014173571 6:118306695-118306717 AAGCCAGAAGTGGAACAGAGGGG - Intronic
1023171317 7:37392582-37392604 GCAGCAGATGTGGAAGAGAGAGG - Intronic
1027189841 7:75990171-75990193 GAACCAGATGGCGAGCTGAGTGG - Intronic
1027513175 7:79109172-79109194 GAAGCAGCTTTGGAACTGAGTGG + Intronic
1032486955 7:132295138-132295160 GAACCAGAATTGGAAAAGAGAGG - Intronic
1033071350 7:138206155-138206177 GAATCATATGTGGAGCCAAGGGG - Intergenic
1034943011 7:155244204-155244226 GACCCAGAAGTGGAACTGAGGGG - Intergenic
1041389771 8:57338191-57338213 GAAAAAGATGTGGAACCCAAGGG - Intergenic
1046439217 8:114236623-114236645 GAGCCAGAAGGGGAACGGAGTGG - Intergenic
1049364532 8:142230708-142230730 GACCCAGAGGGGTAACCGAGGGG - Intronic
1052977665 9:34423370-34423392 GAACCAGATGAGGAAAGGAGTGG + Intronic
1060016904 9:120094649-120094671 GAAGCATATCTGGAACCCAGGGG + Intergenic
1060733820 9:126053761-126053783 GAAGCAGATGAGGCACAGAGAGG + Intergenic
1186546904 X:10459464-10459486 GAATCAGTTTTGGAACCTAGAGG + Intronic
1192260670 X:69504502-69504524 GAACGAGAGGCGGAAGCGAGAGG + Intergenic
1199317306 X:146395708-146395730 GAACCTGTTGTGGGACAGAGGGG - Intergenic