ID: 1148122506

View in Genome Browser
Species Human (GRCh38)
Location 17:45221513-45221535
Sequence CCTCGCCCGAGGCGAGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148122489_1148122506 15 Left 1148122489 17:45221475-45221497 CCCAGGCCGTGATCCCCTTCACC 0: 1
1: 0
2: 2
3: 15
4: 123
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122494_1148122506 1 Left 1148122494 17:45221489-45221511 CCCTTCACCCAGACCCGGCCAAT 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122485_1148122506 25 Left 1148122485 17:45221465-45221487 CCCTCCAATCCCCAGGCCGTGAT 0: 1
1: 0
2: 0
3: 5
4: 130
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122486_1148122506 24 Left 1148122486 17:45221466-45221488 CCTCCAATCCCCAGGCCGTGATC 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122487_1148122506 21 Left 1148122487 17:45221469-45221491 CCAATCCCCAGGCCGTGATCCCC 0: 1
1: 0
2: 1
3: 25
4: 211
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122488_1148122506 16 Left 1148122488 17:45221474-45221496 CCCCAGGCCGTGATCCCCTTCAC 0: 1
1: 0
2: 2
3: 13
4: 133
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122493_1148122506 2 Left 1148122493 17:45221488-45221510 CCCCTTCACCCAGACCCGGCCAA 0: 1
1: 0
2: 0
3: 22
4: 319
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122484_1148122506 26 Left 1148122484 17:45221464-45221486 CCCCTCCAATCCCCAGGCCGTGA 0: 1
1: 0
2: 1
3: 19
4: 210
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122495_1148122506 0 Left 1148122495 17:45221490-45221512 CCTTCACCCAGACCCGGCCAATC 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122497_1148122506 -7 Left 1148122497 17:45221497-45221519 CCAGACCCGGCCAATCCCTCGCC 0: 1
1: 0
2: 1
3: 7
4: 166
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122491_1148122506 9 Left 1148122491 17:45221481-45221503 CCGTGATCCCCTTCACCCAGACC 0: 1
1: 0
2: 1
3: 27
4: 353
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122490_1148122506 14 Left 1148122490 17:45221476-45221498 CCAGGCCGTGATCCCCTTCACCC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1148122496_1148122506 -6 Left 1148122496 17:45221496-45221518 CCCAGACCCGGCCAATCCCTCGC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1148122506 17:45221513-45221535 CCTCGCCCGAGGCGAGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148122506 Original CRISPR CCTCGCCCGAGGCGAGCGGG AGG Intronic