ID: 1148122545

View in Genome Browser
Species Human (GRCh38)
Location 17:45221665-45221687
Sequence CAACCATGGCGGGCGGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148122545_1148122569 29 Left 1148122545 17:45221665-45221687 CCACTCCCCGCCCGCCATGGTTG 0: 1
1: 0
2: 1
3: 17
4: 262
Right 1148122569 17:45221717-45221739 TCCCTCCAGCCCGCCCCCCTGGG 0: 1
1: 0
2: 2
3: 36
4: 382
1148122545_1148122568 28 Left 1148122545 17:45221665-45221687 CCACTCCCCGCCCGCCATGGTTG 0: 1
1: 0
2: 1
3: 17
4: 262
Right 1148122568 17:45221716-45221738 CTCCCTCCAGCCCGCCCCCCTGG 0: 1
1: 0
2: 7
3: 83
4: 796
1148122545_1148122571 30 Left 1148122545 17:45221665-45221687 CCACTCCCCGCCCGCCATGGTTG 0: 1
1: 0
2: 1
3: 17
4: 262
Right 1148122571 17:45221718-45221740 CCCTCCAGCCCGCCCCCCTGGGG 0: 1
1: 0
2: 4
3: 48
4: 443
1148122545_1148122556 -9 Left 1148122545 17:45221665-45221687 CCACTCCCCGCCCGCCATGGTTG 0: 1
1: 0
2: 1
3: 17
4: 262
Right 1148122556 17:45221679-45221701 CCATGGTTGCGGGGGTCCCCCGG 0: 1
1: 0
2: 1
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148122545 Original CRISPR CAACCATGGCGGGCGGGGAG TGG (reversed) Intronic
900464194 1:2816462-2816484 CCACCAAGGCTGGCGGGCAGGGG - Intergenic
902176924 1:14657368-14657390 CCACCATGCCTGGCTGGGAGAGG + Intronic
902254096 1:15176434-15176456 CTGCCATGGCCAGCGGGGAGTGG - Intronic
902258704 1:15207621-15207643 CAACCAGAGCCGGCAGGGAGGGG - Intronic
902833759 1:19034100-19034122 CAAACATGCAGGGCGGGGGGTGG + Intergenic
903180615 1:21603214-21603236 GAGCCCTGGGGGGCGGGGAGCGG - Intronic
903332274 1:22602276-22602298 CACCCATGGGGGCGGGGGAGAGG + Exonic
903868092 1:26412626-26412648 CACCCAGGCCGGGCAGGGAGGGG + Intronic
904433304 1:30479006-30479028 CAACCCTGGGGGCCGGGCAGGGG - Intergenic
905362930 1:37432762-37432784 CCAACATGGTGGGCAGGGAGGGG + Intergenic
905855522 1:41309087-41309109 CAATCATGGCGGAAGGGGAAGGG - Intergenic
907390621 1:54155842-54155864 CAATCATGGCGGAAGGGGAAGGG + Intronic
907669512 1:56462427-56462449 CAACGATGGTGGGTGGGGTGGGG - Intergenic
907784193 1:57595855-57595877 CAATCATGGCGGAAGGGGAAGGG - Intronic
911331836 1:96533312-96533334 GAATCATGGCGGGAGGTGAGAGG - Intergenic
913053241 1:115134982-115135004 CAAGCATGGCGGGTAGGGGGTGG + Intergenic
913335175 1:117703218-117703240 CCACAGTGGAGGGCGGGGAGGGG + Intergenic
916666542 1:166972975-166972997 AAACAATGGCGGCTGGGGAGGGG - Intronic
916694268 1:167220819-167220841 CAAGCAGGGCGGGAGGGGGGAGG + Exonic
917937419 1:179882498-179882520 CAACTATGGCGGGCGACGGGCGG + Exonic
920272297 1:204774934-204774956 CAATCATGGCGGAAGGGGAAGGG - Intergenic
922458429 1:225796271-225796293 CAAACAGGGCGGCCGGGCAGAGG + Intergenic
922550922 1:226493810-226493832 CAACCATGGCGGGGAGGGGTGGG - Intergenic
922933341 1:229407032-229407054 AGACCAGGGCGGGAGGGGAGGGG - Intergenic
923038867 1:230305424-230305446 CAATCATGGTGGGAGGGGAAGGG + Intergenic
923243729 1:232110795-232110817 CAACCCTGGGGGGAGGGGAGCGG + Intergenic
923964036 1:239116330-239116352 CAATCATGGCGGAAGGGGAAGGG - Intergenic
1063857462 10:10271451-10271473 CAACCATGGCGGAAGGTGAAAGG + Intergenic
1063977419 10:11428541-11428563 TAACCATGGCAGGCTGGGTGCGG - Intergenic
1064657888 10:17574196-17574218 CAATCATGGCGGAAGGGGAAGGG - Intergenic
1065109559 10:22426319-22426341 CATCCAAGGCGGGGGGGGGGGGG + Intronic
1065889491 10:30109095-30109117 CAAGCATGGGGGCTGGGGAGGGG - Intronic
1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG + Intergenic
1066325061 10:34350624-34350646 CCATCTTGGCGGGGGGGGAGGGG + Intronic
1066418836 10:35245982-35246004 CAATCATGGCGGAAGGGGAAGGG + Intergenic
1067449937 10:46376002-46376024 CAAGCATGGAGGGTGGGAAGGGG + Intronic
1067587307 10:47483761-47483783 CAAGCATGGAGGGTGGGAAGGGG - Intronic
1067634366 10:47991528-47991550 CAAGCATGGAGGGTGGGAAGGGG - Intergenic
1068788444 10:61001706-61001728 CAGCCCTGGGGGGCGGGGGGAGG - Intergenic
1072692707 10:97582430-97582452 CACCCATGGCGGGTGAGCAGCGG - Intronic
1074434516 10:113422574-113422596 CAACATTGGTGGGCGGGGAGAGG - Intergenic
1074626332 10:115191748-115191770 CAATCATGGCGGAAGGGGAAGGG - Intronic
1074788556 10:116863744-116863766 CCACCATCGCGGCAGGGGAGGGG - Intronic
1075282706 10:121154158-121154180 CAAGCAAGGGGGGCGGGGAATGG - Intergenic
1075920387 10:126207019-126207041 CAATCATGGCGGACGGTGAAAGG - Intronic
1076885820 10:133261914-133261936 CCAGCATGGCGGGGGGGGTGCGG + Intergenic
1077517161 11:3008940-3008962 CACCCATGGCGGGTGGGCTGGGG - Intronic
1079392847 11:20037153-20037175 CAAAGATGGGGGGTGGGGAGGGG - Intronic
1081492527 11:43579404-43579426 CACCCGTGGGGGGCGGGGAGGGG + Intronic
1083922435 11:65787874-65787896 CCACTTTGGGGGGCGGGGAGCGG + Intronic
1083952547 11:65965037-65965059 CGCCCATGGCTGGTGGGGAGAGG - Intronic
1084070198 11:66728555-66728577 CAACTACCCCGGGCGGGGAGCGG - Intronic
1086135600 11:83441213-83441235 CAATCATGGCGGAAGGGGAAGGG + Intergenic
1086261896 11:84949515-84949537 ACACCCTGGCGGGCGGGGGGTGG + Intronic
1086589427 11:88494617-88494639 CAACCATGGCGGAAGGCAAGGGG - Intergenic
1087236881 11:95729693-95729715 CAAGCATGGCGGGAGGTGAAAGG - Intergenic
1087763537 11:102126536-102126558 GAATCATGGCGGGAGGTGAGAGG - Intronic
1087997097 11:104822590-104822612 CAATCATGGTGGGAGGTGAGAGG - Intergenic
1093483167 12:19625958-19625980 GAACCATGGCAGGAGGAGAGAGG - Intronic
1093899903 12:24619981-24620003 CACCCATGCCTGTCGGGGAGTGG - Intergenic
1096718029 12:53502586-53502608 CAACATGGGCGGGCGGGGGGAGG - Intronic
1096782817 12:54000752-54000774 CAACCGGCGCGGGAGGGGAGGGG + Intronic
1097576426 12:61399107-61399129 CAATCATGGCGGAGGGGAAGGGG + Intergenic
1099184447 12:79502672-79502694 CAATCATGGAGGACGGGGAAGGG + Intergenic
1101635676 12:106539508-106539530 CAATCATGGCGGAAGGGGAAGGG + Intronic
1102681949 12:114696833-114696855 AAACCCTGGCGGCGGGGGAGGGG - Intergenic
1103728243 12:123009670-123009692 AACCCATGGCTGGCGGGTAGTGG + Intronic
1103895227 12:124268794-124268816 CAATCATGGCGGGAGGTGAAGGG + Intronic
1103941741 12:124505076-124505098 CAGCCATGGCCGGCTGGAAGTGG + Intronic
1104637609 12:130447835-130447857 CCTGCATGGAGGGCGGGGAGAGG + Intronic
1104669324 12:130669592-130669614 CAACCATGGCGGAAGGTGAAGGG - Intronic
1105293849 13:19071631-19071653 CAGCCTTGGCGGGGGAGGAGGGG - Intergenic
1105989261 13:25602301-25602323 GAAACAGGGCTGGCGGGGAGGGG + Intronic
1106576658 13:30981171-30981193 CAACCATGGCCAGAGAGGAGAGG - Intergenic
1107445336 13:40465609-40465631 CAACCAGGGCAGGCTGGGCGCGG - Intergenic
1107941498 13:45381627-45381649 CCACCATCGCAGGAGGGGAGGGG - Intergenic
1108313398 13:49217201-49217223 CCACCATGGTGGGTGGGGAAGGG + Intergenic
1109794480 13:67292134-67292156 CAATCATGGCGGAAGGGGAAGGG + Intergenic
1110462473 13:75760244-75760266 CAACCTTGGAGGGAGGGGATAGG + Intronic
1113035798 13:106047395-106047417 CAACCATGGCGGAAGGTGAAGGG - Intergenic
1113587791 13:111477067-111477089 CAATCATGGCGGGAGGCGAAGGG - Intergenic
1114664313 14:24369066-24369088 CAACCGTGGCCAGAGGGGAGGGG - Intronic
1115452502 14:33564481-33564503 CAGCTATGGCTGGCGGGGAATGG - Intronic
1115750520 14:36485053-36485075 CAGTCATGGCGGGCAGGGAAAGG + Intronic
1116045211 14:39734553-39734575 AAGCCATGGCAGGCAGGGAGGGG - Intergenic
1117735535 14:58765163-58765185 CAATAATGGCAGGCAGGGAGGGG - Intergenic
1118883822 14:69850448-69850470 CAGCCATGGCGGGGCGGCAGGGG - Intergenic
1118898778 14:69969394-69969416 CAATCATGGCGGAAGGGGAAGGG + Intronic
1118932408 14:70255008-70255030 CAGGCATGGCGGGCGGCGGGCGG - Intergenic
1118932419 14:70255040-70255062 CAGGCATGGCGGGCGGGCAGGGG - Intergenic
1118932433 14:70255072-70255094 CAGGCATGGCGGGCGGGGAGGGG - Intergenic
1118933313 14:70263274-70263296 GAACCATGGCAGGAGGGGAAAGG - Intergenic
1122089562 14:99329240-99329262 CAATCATGGCGGAAGGGGAAGGG - Intergenic
1123449350 15:20350296-20350318 TCACCCTGGCGGGCAGGGAGTGG + Intergenic
1123698813 15:22899585-22899607 CAATCATGGCGGAAGGTGAGAGG - Intronic
1129175506 15:73837094-73837116 AAAGCATAGCAGGCGGGGAGGGG + Intergenic
1129467930 15:75734267-75734289 CAGCCAGGGCTGGTGGGGAGTGG - Intergenic
1129719330 15:77869464-77869486 CAGCCGGGGCTGGCGGGGAGTGG + Intergenic
1130284014 15:82540638-82540660 CAACCGAGGGGAGCGGGGAGCGG - Intronic
1133002433 16:2858098-2858120 CCACCATGGCTGGTGGGGCGGGG + Exonic
1133459774 16:5977361-5977383 TGACCATGGAGGGCAGGGAGCGG - Intergenic
1134251619 16:12578196-12578218 CAACCATGACAGGCCAGGAGAGG + Intergenic
1134330551 16:13247078-13247100 CAATCATGGCGGAAGGGGAAGGG + Intergenic
1134758486 16:16691327-16691349 CAATCATGGCGGAAGGGGAAGGG - Intergenic
1134987586 16:18667851-18667873 CAATCATGGCGGAAGGGGAAGGG + Intergenic
1135511081 16:23083686-23083708 CAAACCTGGCGGGGGGGGGGGGG + Intronic
1137472621 16:48775453-48775475 CAATCATGGCAGAAGGGGAGAGG + Intergenic
1137671283 16:50281099-50281121 CAACCATGGGGTCCAGGGAGAGG - Intronic
1138518616 16:57556004-57556026 CAATCATGGCGGGAGGCGAAGGG - Intronic
1143172522 17:4938425-4938447 CAGCCCTGGAGGGAGGGGAGCGG + Exonic
1144148121 17:12417837-12417859 CAATCATGGCGGAAGGGGACAGG + Intergenic
1147218617 17:38915152-38915174 TAACCCTGGCCGGAGGGGAGAGG + Intronic
1148122545 17:45221665-45221687 CAACCATGGCGGGCGGGGAGTGG - Intronic
1149090289 17:52769863-52769885 CAGCCATTGCGGGTGGGAAGAGG + Intergenic
1149943738 17:60899098-60899120 CAGCCATGGTGGGTGGGGACAGG + Intronic
1151766676 17:76136700-76136722 CATCCCTAGGGGGCGGGGAGGGG - Exonic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1153047618 18:871132-871154 CAATCATGGCGGGAGGTGAAGGG - Intergenic
1155221385 18:23689375-23689397 CAAACTTCGCGGGCGGGGAATGG - Intergenic
1157142698 18:45126584-45126606 CAATCATGGCGGAGGGGAAGAGG - Intergenic
1160788795 19:913310-913332 AAACCCAGGCGCGCGGGGAGGGG + Intergenic
1160902419 19:1435005-1435027 CAACCTTGGGGGGGGGGGCGGGG + Exonic
1160913698 19:1487071-1487093 AAACCAGGAGGGGCGGGGAGGGG + Intronic
1161238684 19:3210160-3210182 CAACCCTGGATGGCGGGCAGTGG + Intergenic
1161556215 19:4944286-4944308 GAGCCCTGGCAGGCGGGGAGGGG - Intronic
1162111325 19:8401463-8401485 GAACCCTGGGGGGCGGGGGGCGG - Intronic
1162126058 19:8500046-8500068 CACCCATGGGGGGAGGGCAGTGG - Intronic
1162145613 19:8610939-8610961 GAACCGCGGGGGGCGGGGAGGGG + Intergenic
1162396452 19:10420441-10420463 CAGCCGCGGCGGGCGGGGGGCGG + Intronic
1163250658 19:16124712-16124734 CAAGCACGGGGGGCGGGGGGGGG - Intronic
1163427073 19:17245676-17245698 CGCCCGTGGCGGGGGGGGAGGGG + Exonic
1166106745 19:40601383-40601405 CAGCCATGGCGGGCGGCGTGCGG + Intronic
1166130463 19:40742844-40742866 CCACCCTGGAGGGCCGGGAGAGG - Intronic
925153454 2:1633286-1633308 CAACCAGGGCCGGCTGGGAGCGG + Exonic
925641181 2:5987073-5987095 CATGCATGGTGGGTGGGGAGAGG - Intergenic
926283957 2:11472654-11472676 CAATCATGGCGGAAGGTGAGGGG + Intergenic
928129774 2:28641177-28641199 CAGCCATGGAGGGAGGGGAGAGG + Intronic
928197189 2:29224391-29224413 CAACCCTAGAGGGTGGGGAGTGG - Intronic
928823112 2:35387136-35387158 CAATCATGGCGGGGGGTGAAAGG + Intergenic
929755531 2:44761082-44761104 CAACCCTTGGGGGCAGGGAGTGG + Intronic
932231549 2:70087728-70087750 CATCCATGGCGAGCGGCGGGCGG - Exonic
932428132 2:71656662-71656684 GAATCATGGCGGGAGGGGAAAGG + Intronic
932644576 2:73487582-73487604 GCAACATGGCAGGCGGGGAGGGG + Intronic
933885988 2:86719946-86719968 CAACCAATGGGCGCGGGGAGTGG - Intronic
933924191 2:87076760-87076782 CAACCAATGGGCGCGGGGAGTGG + Intergenic
934942996 2:98515846-98515868 CAGCCATGGGGGGCAGGGAAAGG - Intronic
942317562 2:174709650-174709672 AGCCCATGGTGGGCGGGGAGGGG + Intergenic
943580319 2:189675952-189675974 CAATCATGGCGGAAGGGGAAGGG - Intronic
945980534 2:216307080-216307102 CTACCAGGGCGGGAGGAGAGAGG - Intronic
946175270 2:217918745-217918767 CGAGGAGGGCGGGCGGGGAGGGG - Intronic
946882840 2:224193531-224193553 CAATCATGGCAGAAGGGGAGGGG + Intergenic
947460453 2:230299637-230299659 AAGCCATGGCAGGCAGGGAGGGG + Intronic
947647084 2:231750183-231750205 CAATCATGGCGGGAGGCGAAAGG - Intronic
948226857 2:236318119-236318141 CAAGGAGGGCGGGCGGGGTGGGG - Intergenic
948988651 2:241541077-241541099 CAAGCAGGGCGGGCGCGGAGCGG - Intergenic
1170138794 20:13104453-13104475 CAATCATGGCGGAAGGGGAAAGG - Intronic
1170406563 20:16044142-16044164 CAATCATGGCGGGAGAGGAAGGG + Intronic
1170803750 20:19611949-19611971 CAACCAAGGTGGGCAGGCAGGGG - Intronic
1171497960 20:25570472-25570494 CAATCATGGCGGAAGGCGAGTGG - Intronic
1172006693 20:31823016-31823038 CACCCATGGCGGGGCGGGACCGG - Intronic
1172561591 20:35893592-35893614 AAGCCATGGCCGGCTGGGAGTGG - Intronic
1173981474 20:47227349-47227371 CAACCACGGCTGGCTGTGAGGGG + Intronic
1174872772 20:54199099-54199121 CAATCATGGCGGGAGGTGAAGGG - Intergenic
1176034079 20:63028017-63028039 GAACCAACGCGGGCGGGGAGTGG + Intergenic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1177862469 21:26470573-26470595 CAATCATGGCGGAAGGGGAAGGG - Intronic
1178948221 21:36966048-36966070 CAGCTGTGGCGGGCCGGGAGCGG - Intronic
1179143959 21:38751543-38751565 CAACCATGGCGGAAGGAGAAGGG - Intergenic
1179437177 21:41369846-41369868 CAGCCACGGCGGGGCGGGAGCGG - Intronic
1179437229 21:41370106-41370128 CCACCATGGCGGGTGGGTAAAGG + Intronic
1179951673 21:44711988-44712010 CGACCATGGCAGGCCGGGAGCGG + Intergenic
1180069177 21:45427585-45427607 GCACCACGGCGGGCGGGGAGCGG + Intronic
1180843887 22:18971194-18971216 CCTCCAGGGCGGGCGGTGAGAGG + Intergenic
1180946926 22:19700351-19700373 CAACCATGGCTGACGGTGAAGGG + Intergenic
1181057587 22:20267512-20267534 CCTCCAGGGCGGGCGGTGAGAGG - Intronic
1181814867 22:25430203-25430225 CAACCAGGGCTGGAGGGCAGAGG + Intergenic
1184141852 22:42582105-42582127 GAGCCATGGCGGGCGGGGCCGGG - Intergenic
1184770351 22:46593498-46593520 GTCCCATGGCGGGCGGGCAGAGG + Intronic
1185226682 22:49657453-49657475 CAATCATGGCGGAAGGGGAAGGG + Intronic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
949740228 3:7224218-7224240 CAATCATGGCGGAAGGGAAGGGG + Intronic
951179683 3:19644626-19644648 CAATCATGGCGGGAGGTGAAGGG - Intergenic
952068258 3:29599129-29599151 CAAGCATGGTGGGCAGAGAGTGG + Intronic
954706704 3:52484859-52484881 CAACCAAGGTGGGTGGGGAAGGG - Intronic
956865696 3:73366674-73366696 CAACGATGGGGGGCGGTGGGGGG + Intergenic
957597861 3:82290386-82290408 TGATAATGGCGGGCGGGGAGGGG + Intergenic
959054324 3:101552792-101552814 CAATCATGGCGGAAGGGGAAAGG - Intergenic
961177821 3:124850537-124850559 AAACCATGGGGTGGGGGGAGGGG + Intronic
962260528 3:133900276-133900298 CATCCATTGCTGGTGGGGAGTGG - Intergenic
963817506 3:149848380-149848402 CAAAGATGGCTGGAGGGGAGTGG + Intronic
968287150 3:197515480-197515502 CAGCCATGACGGGTGGGGAGTGG - Intronic
968489223 4:881186-881208 CCACCGTGGCGGGAGGGAAGAGG - Intronic
968775411 4:2536900-2536922 GGCTCATGGCGGGCGGGGAGAGG - Intronic
971245005 4:24919497-24919519 CAACCTTGGCGGGCAGGGGGTGG + Intronic
971515074 4:27475369-27475391 CTACCATGGTGGGTGGAGAGGGG - Intergenic
971599082 4:28569509-28569531 CAACCATGGCGAAAGGGGAAAGG + Intergenic
977579994 4:98714460-98714482 CAACCATGGTGGAAGGTGAGGGG + Intergenic
978030631 4:103937066-103937088 CACCCGTGGGGGGCGGGGTGGGG - Intergenic
981738203 4:147974812-147974834 CAATCATGGCGGAAGGGGAAAGG + Intronic
985177500 4:187216944-187216966 CAATCATGGCGGAGGGGGAAGGG + Intergenic
985293033 4:188405762-188405784 CAACCATGGGGGACTGGGTGAGG - Intergenic
985549149 5:524448-524470 CCACCCCGGCGGGCGGGGATCGG - Intergenic
985785933 5:1894575-1894597 CAATCATGGCGGGAGGTGAAAGG - Intergenic
989991662 5:50774442-50774464 CAGCCAAGGCGGCCGGGCAGAGG + Intronic
990075561 5:51842765-51842787 GAATCATGGCGGGAGGGGAAAGG + Intergenic
992408148 5:76479083-76479105 CAACCATGGCGGGAAGGCGGAGG - Intronic
994864747 5:105253060-105253082 CAATCATGGCGGGAGGTGAAAGG - Intergenic
995545818 5:113229158-113229180 CCAACATGGCGGATGGGGAGGGG + Intronic
996815955 5:127572668-127572690 CTACCATGGTGGGTGGGGTGGGG + Intergenic
997592076 5:135080399-135080421 CAATCATGGCGGAAGGGGAAAGG + Intronic
998288477 5:140887529-140887551 TAACCATGAGGGGTGGGGAGAGG - Intronic
998392265 5:141795026-141795048 CAACCATGCCAGGTGGGGATAGG - Intergenic
999115041 5:149155458-149155480 AAACCATGGCGGGTGCTGAGAGG + Intronic
999140449 5:149358053-149358075 GGGCCATGGCGGGCGGCGAGCGG - Exonic
999287949 5:150405317-150405339 CAGCCATGATGGGAGGGGAGGGG + Intronic
999655702 5:153808377-153808399 CCACGACGGGGGGCGGGGAGTGG + Intronic
1001798044 5:174518673-174518695 CCCACATGGCGGGGGGGGAGGGG - Intergenic
1002441178 5:179265310-179265332 AAACCATGTCGGGAGGGGAGAGG + Intronic
1002926853 6:1610017-1610039 TAACCAGGGCGGGGGGGGGGGGG - Exonic
1006313438 6:33277267-33277289 GCACCCTGGGGGGCGGGGAGAGG - Exonic
1006485779 6:34340401-34340423 CCATCATGGAGGGAGGGGAGGGG - Intronic
1006790167 6:36695121-36695143 CAATCATGGCGGAAGGTGAGGGG + Intergenic
1007370665 6:41425074-41425096 AATCCATGGGGGGCGGGGGGCGG - Intergenic
1007521320 6:42453139-42453161 CAGTCATGGCGCGCGAGGAGGGG - Intergenic
1009980479 6:70720756-70720778 CAGCCATGGCTGGAGCGGAGAGG + Intronic
1015824050 6:137293259-137293281 CAGGCATGGTGGGCTGGGAGTGG - Intergenic
1016134302 6:140520092-140520114 CAATCATGGCGGAAGGTGAGAGG - Intergenic
1017629753 6:156384898-156384920 CAATCATGGCGGAAGGTGAGGGG - Intergenic
1017632454 6:156410247-156410269 CATCAATGGCGGGCCGGGCGAGG + Intergenic
1017814338 6:158005861-158005883 CAGACATGGTGGGCGGGTAGTGG - Intronic
1019413637 7:917363-917385 CTACCAGGGAGGGCTGGGAGGGG + Intronic
1019504025 7:1381698-1381720 CACCCTTGGGGGGCTGGGAGGGG - Intergenic
1019956733 7:4420961-4420983 CAATCATGGCGGGCAGTGAAGGG - Intergenic
1020092751 7:5350424-5350446 AAAACAGGGCGGGCGGGGGGCGG + Intronic
1020106163 7:5423276-5423298 GGACCAGGGCCGGCGGGGAGGGG - Intronic
1020722908 7:11771949-11771971 CAACCATGGCGGAAGGTGAAAGG - Intronic
1021447030 7:20744611-20744633 CATCCATGGGGGGAGGGGGGAGG + Intronic
1023986580 7:45100602-45100624 CAGGCAGTGCGGGCGGGGAGAGG + Intronic
1026642633 7:72140584-72140606 CAACCTTGGCAGGCAGGGTGTGG + Intronic
1029670936 7:102030375-102030397 CAAAAGTGGTGGGCGGGGAGGGG - Intronic
1035328980 7:158084282-158084304 CAGACGTGGCGGGCGGGGTGGGG - Intronic
1035587816 8:789297-789319 CAACCATGGCGGAAGGCGAAGGG + Intergenic
1037673834 8:21037731-21037753 CAATCATGGCGGAAGGGGAAGGG - Intergenic
1038154044 8:24970751-24970773 CAATCATGGCGGACGGTGAAGGG + Intergenic
1045571067 8:103370325-103370347 CAATCCTGGCGGGTTGGGAGGGG - Intergenic
1046031467 8:108787611-108787633 CCGCCACGGCGGGCGGGGTGGGG + Exonic
1046770293 8:118111302-118111324 CACCCAGGGCGGGCGAGCAGCGG + Exonic
1048866927 8:138768187-138768209 GAACCATGGGGGGCTGGGAAAGG - Intronic
1049628191 8:143636126-143636148 CACCCGGCGCGGGCGGGGAGAGG - Intronic
1049762232 8:144336769-144336791 CAACCGGCGCGGGCGGAGAGGGG + Intergenic
1051053374 9:12956037-12956059 AAGCCATGGCAGGTGGGGAGGGG - Intergenic
1052462029 9:28777080-28777102 CAATCATGGCGGAAGGGGAGGGG - Intergenic
1052565218 9:30141021-30141043 CAATCATGGCGGAAGGGGAAGGG + Intergenic
1054762085 9:69012899-69012921 CAACCCTGGAGGGTGGGGTGAGG + Exonic
1056847807 9:90055767-90055789 CAATCATGGCGGAAGGTGAGGGG - Intergenic
1058673975 9:107384836-107384858 CAAACTTGGGGGGAGGGGAGTGG + Intergenic
1062332384 9:136050515-136050537 GAGACATGGCGGGCGGGCAGCGG + Exonic
1062629309 9:137456596-137456618 CAGCCAGGGCGGGTGGGGGGAGG + Intronic
1062670146 9:137703993-137704015 CAATCATGGCGGGAGGGCAAAGG + Intronic
1203794674 EBV:169995-170017 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203794875 EBV:170533-170555 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203795066 EBV:171056-171078 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203795267 EBV:171594-171616 CCCCCAAGGGGGGCGGGGAGCGG + Intergenic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1185625132 X:1475922-1475944 CAACCATGGCAGGTGAGGAGAGG - Intronic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1187988328 X:24839578-24839600 GAGCCATGGCTGGTGGGGAGGGG + Intronic
1189744685 X:44157739-44157761 GAACCAAGCGGGGCGGGGAGGGG - Intronic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic
1191016951 X:55819209-55819231 AAGCCATGGCAGGCAGGGAGGGG - Intergenic
1192664178 X:73069920-73069942 CAGACAGGGCGGCCGGGGAGAGG - Intergenic
1194123960 X:89991344-89991366 CAACCATTGCAGCCAGGGAGAGG + Intergenic
1195567840 X:106363338-106363360 CTACAATGGTGGCCGGGGAGGGG + Intergenic
1197871214 X:131064430-131064452 CAACCATGGTGTTCAGGGAGTGG - Intronic
1199967430 X:152831572-152831594 CGAGCATGAGGGGCGGGGAGAGG + Intronic
1200476848 Y:3648966-3648988 CAACCATTGCAGCCAGGGAGAGG + Intergenic