ID: 1148123819

View in Genome Browser
Species Human (GRCh38)
Location 17:45226815-45226837
Sequence GGGTCCCCACAGCTGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 545}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148123819_1148123823 -8 Left 1148123819 17:45226815-45226837 CCTTGTCCCAGCTGTGGGGACCC 0: 1
1: 0
2: 5
3: 39
4: 545
Right 1148123823 17:45226830-45226852 GGGGACCCTTGAACTCTGATGGG 0: 1
1: 0
2: 0
3: 7
4: 111
1148123819_1148123827 13 Left 1148123819 17:45226815-45226837 CCTTGTCCCAGCTGTGGGGACCC 0: 1
1: 0
2: 5
3: 39
4: 545
Right 1148123827 17:45226851-45226873 GGAGAAGCTGTTAGCTCTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 165
1148123819_1148123822 -9 Left 1148123819 17:45226815-45226837 CCTTGTCCCAGCTGTGGGGACCC 0: 1
1: 0
2: 5
3: 39
4: 545
Right 1148123822 17:45226829-45226851 TGGGGACCCTTGAACTCTGATGG 0: 1
1: 0
2: 1
3: 15
4: 223
1148123819_1148123826 12 Left 1148123819 17:45226815-45226837 CCTTGTCCCAGCTGTGGGGACCC 0: 1
1: 0
2: 5
3: 39
4: 545
Right 1148123826 17:45226850-45226872 GGGAGAAGCTGTTAGCTCTTTGG 0: 1
1: 0
2: 1
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148123819 Original CRISPR GGGTCCCCACAGCTGGGACA AGG (reversed) Intronic
900119515 1:1042488-1042510 GGGTCCTCACTCTTGGGACATGG + Intronic
900521904 1:3109991-3110013 GTGTCCCCACATCCAGGACACGG - Intronic
900521940 1:3110109-3110131 GTGTCCCCACACCCAGGACATGG - Intronic
900521951 1:3110148-3110170 GTGTCCCCACACCCAGGACATGG - Intronic
900521997 1:3110305-3110327 GTGTCCCCACACCCAGGACATGG - Intronic
900522011 1:3110345-3110367 GTGTCCCCACACCCAGGACATGG - Intronic
900522022 1:3110384-3110406 GTGTCCCCACACCCAGGACATGG - Intronic
900522043 1:3110463-3110485 GTGTCCCCACACCCAGGACATGG - Intronic
900522064 1:3110542-3110564 GTGTCCCCACACCCAGGACATGG - Intronic
900683584 1:3932586-3932608 GAGTCCCCACAGCTGATACTGGG + Intergenic
901299579 1:8189667-8189689 GGGTGCCCATGGCTGGGGCAGGG - Intergenic
901810543 1:11764705-11764727 GGGCCCCCACAGCTCGGTCCTGG + Intronic
902777158 1:18682399-18682421 GGGGCCCAACAGCTGGCAAAGGG - Intronic
902919114 1:19656160-19656182 GTGTCCCCAGAGCTGGCACAGGG + Intronic
903799053 1:25953133-25953155 CTGGCCCCACAGCTGGGACCTGG + Intergenic
904536753 1:31204485-31204507 GGGTCCCGGCATCTGGGAGATGG - Intronic
905340343 1:37273640-37273662 GGCCCCCCACAGATGGGCCAGGG + Intergenic
906702260 1:47868412-47868434 GGGTCCCCAATCCTGGGTCATGG + Intronic
907333771 1:53687621-53687643 GGGTCCCCCCAGCTAGGAAGGGG + Intronic
908255690 1:62301826-62301848 GGCACCTAACAGCTGGGACAAGG + Intronic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909374512 1:74924328-74924350 GGGTCCTCCCAGCTGGGTCCTGG + Intergenic
909788245 1:79642100-79642122 GGTCCCGCACAGATGGGACACGG + Intergenic
910292852 1:85616146-85616168 GGTTCCACAAAGCTGGGGCACGG - Intergenic
911027380 1:93448821-93448843 GGGTCCCCATACCTGGGGCGAGG - Intronic
911251668 1:95583597-95583619 GAGACCCCAGAGCTGGCACACGG - Intergenic
911375388 1:97044760-97044782 GGCTCCCCACTGCAGGGAAAGGG - Intergenic
911759759 1:101601410-101601432 GGTCCCGCACAGATGGGACATGG + Intergenic
912296494 1:108475286-108475308 GGTCCCGCACAGATGGGACACGG - Intergenic
915449554 1:155995092-155995114 GGGTGGGCACAGCTGAGACAAGG - Intronic
916328880 1:163593356-163593378 GGTCCCGCACAGATGGGACAAGG - Intergenic
917749676 1:178042312-178042334 GGTCCCGCACAGATGGGACATGG - Intergenic
919813897 1:201425924-201425946 GGGTCCCCCTCCCTGGGACAAGG + Intronic
920901507 1:210114188-210114210 GGTCCCTCACAGATGGGACATGG + Intronic
922048435 1:221968290-221968312 GGTCCCGCACAGATGGGACACGG - Intergenic
922150821 1:223002579-223002601 GGGGCCAGACTGCTGGGACATGG + Exonic
922332962 1:224593978-224594000 GGTTACCAACAGCTGGGAGAAGG + Intronic
922598995 1:226835602-226835624 GGGCCTGCACAGATGGGACATGG - Intergenic
922702762 1:227771471-227771493 GGGCCCCCACACCTGGTCCAGGG - Intronic
922720704 1:227898938-227898960 GGGTCTGCAGAGCTGGGACAAGG - Intergenic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923075230 1:230603564-230603586 GGTCCCGCACAGATGGGACATGG - Intergenic
923147700 1:231209630-231209652 GTGTCCTCACAGCTGTGACCAGG + Intronic
923161325 1:231317379-231317401 GGGTCCCCACAGCTCAGCGACGG - Intergenic
923685067 1:236148004-236148026 TGTTCCCCAAAGCTGGCACAAGG - Intronic
923770715 1:236935630-236935652 GGTCCCGCACAGATGGGACATGG + Intergenic
923962809 1:239103705-239103727 GGTCCCGCACAGATGGGACATGG - Intergenic
923982730 1:239343554-239343576 GAGCCACCACACCTGGGACACGG + Intergenic
924406603 1:243754504-243754526 GGGTCCCCACCCCTGGGCCGCGG + Intronic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1064012213 10:11743630-11743652 GGGTGCCCACAGCAGGGGCAGGG + Intronic
1064247611 10:13681739-13681761 AAGTCCCCACAGCTGGTAAACGG - Intronic
1064663791 10:17630221-17630243 GGTCCCGCACAGATGGGACACGG + Intergenic
1065328008 10:24567708-24567730 GGGTCTCCACACTTGGAACATGG + Intergenic
1067360428 10:45573547-45573569 GGTCCCGCACAGATGGGACAAGG - Intronic
1067457486 10:46430256-46430278 TGGTCACCAGAGCTGGGAAAAGG - Intergenic
1067629712 10:47954378-47954400 TGGTCACCAGAGCTGGGAAAAGG + Intergenic
1067927881 10:50529031-50529053 TGGTTCCTACAGCTGGAACATGG + Intronic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1068602517 10:58970407-58970429 GAGTCCCCACCCCTGGGCCATGG - Intergenic
1069823280 10:71240371-71240393 GGGTCCCCCCTACTGGGAGAAGG - Intronic
1069886474 10:71627075-71627097 GTGTCCACACAGCTGGTACCTGG + Intronic
1070820547 10:79351610-79351632 GTGTCCCCACAGCTCTGACCTGG + Intronic
1071550769 10:86564614-86564636 GGTCCCGCACAGATGGGACATGG + Intergenic
1072580284 10:96734547-96734569 GGTCCCGCACAGATGGGACACGG - Intergenic
1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG + Exonic
1073459709 10:103659626-103659648 GAGGCCTCACAGCAGGGACATGG + Intronic
1075248720 10:120847183-120847205 GGTCCCGCACAGATGGGACACGG - Intergenic
1076700749 10:132271425-132271447 GGGCCCACACTGTTGGGACAAGG - Intronic
1077015465 11:397230-397252 GGGTCCGCACGGCAGGGGCACGG - Exonic
1077137465 11:1008214-1008236 GGGTCCCCTCAGGAAGGACACGG - Intronic
1077175458 11:1187862-1187884 TGGACCCCACGGCGGGGACAAGG + Intronic
1077176210 11:1192077-1192099 TGGACCCCACGGCGGGGACAAGG + Intronic
1077222042 11:1422132-1422154 GGGGGCCCACAGCTGGGGCTGGG - Intronic
1077295964 11:1826442-1826464 GGGTCCCCACACTTAGGACCCGG - Intergenic
1077378615 11:2217473-2217495 GAGTCCCACCTGCTGGGACAAGG + Intergenic
1077505836 11:2929641-2929663 GGGGCCGGACAGCTGGGGCACGG - Intergenic
1077507998 11:2941042-2941064 GGGTCCAAACAGCTGGGCCTGGG + Intergenic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1078146450 11:8724906-8724928 TGGGCTCCCCAGCTGGGACATGG + Intronic
1078626529 11:12963397-12963419 TGGTTCCCAAGGCTGGGACAAGG + Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1082901234 11:58255625-58255647 GTGTCCCAAGAGCTAGGACAGGG - Intergenic
1083618102 11:64036189-64036211 GGGTCCGCGCGTCTGGGACAGGG + Intronic
1084047189 11:66575953-66575975 GGTCCCACACAGGTGGGACACGG - Intergenic
1084172190 11:67406026-67406048 GGGTTCCCAGAGCAGGGTCAAGG - Intronic
1084245576 11:67854785-67854807 GGTCCCGCACAGATGGGACATGG + Intergenic
1084359772 11:68661771-68661793 TGGTCTCCACAGCTGGAACGGGG - Intergenic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1084959629 11:72709733-72709755 GGGGCTCCACAGGTGGGGCAGGG + Intronic
1084968433 11:72756427-72756449 GGGTCCCCAGGGCTGGCCCAGGG - Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085259278 11:75195130-75195152 GTCACCCCACAGCTGGAACAGGG + Intronic
1085392269 11:76188588-76188610 GGGTCCCCACATGTGGGCCGAGG + Intronic
1085520628 11:77137241-77137263 GGGTTCCCAAGGCTGGGACAGGG + Intronic
1086005044 11:82027555-82027577 GGTCCCGCACAGATGGGACATGG - Intergenic
1086600811 11:88630962-88630984 CTGTCCCCACAGCTGTGACATGG - Intronic
1086907779 11:92436711-92436733 TGGACCCCAAAGCTGGCACAGGG - Intronic
1088442704 11:109889230-109889252 GGGGGCCCACAGCTGGGATGAGG - Intergenic
1089495028 11:118903404-118903426 GCGGCCCCACAGCTGGGTCCCGG - Exonic
1089680899 11:120118346-120118368 AGGCCCCCACAGCTGGGAGTGGG + Intronic
1089740550 11:120579115-120579137 GGATCCTCAGTGCTGGGACAGGG - Intronic
1089753270 11:120667045-120667067 GGGGCCACACAGGTCGGACAGGG + Intronic
1089781219 11:120874533-120874555 AGCTCCACACAGCTGGGAAAGGG + Intronic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090119455 11:124009698-124009720 GGGCGTCCAGAGCTGGGACATGG - Intergenic
1090289281 11:125527899-125527921 GTGTCCCCAGGGCTGGGGCAAGG - Intergenic
1090767857 11:129892649-129892671 GGTTTCCCACAGCTGTTACAAGG + Intronic
1092104615 12:5912646-5912668 GGGACCGCACAGCTGAGACAGGG - Intronic
1092509212 12:9135680-9135702 GGATCTTCACAGCTGTGACATGG - Intergenic
1092739301 12:11613072-11613094 GGTCCCGCACAGATGGGACATGG + Intergenic
1092789730 12:12060727-12060749 GGTCCCGCACAGATGGGACACGG - Intronic
1092905879 12:13100550-13100572 GGGTCCACCCAGCTTGGAAAAGG - Intronic
1093024355 12:14232914-14232936 GGTCCCGCACAGATGGGACACGG - Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1094372228 12:29750949-29750971 GGGGCTCCCCTGCTGGGACAGGG - Intronic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1095999002 12:48113508-48113530 GGTCCCGCACAGATGGGACATGG + Intronic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1102639651 12:114355731-114355753 GGCTCCCCACAGCTGGGAGAGGG - Exonic
1103724793 12:122992229-122992251 GGGTCCCCGGAGCAGGGAAAGGG - Intronic
1103927626 12:124432667-124432689 GGGTCCTCACAGCTGGTCCTTGG - Intronic
1104024787 12:125017899-125017921 AGGGTCCCACAGCTAGGACAGGG - Intronic
1105303520 13:19154418-19154440 GGCACCACACAGGTGGGACAGGG + Intergenic
1105704536 13:22960975-22960997 GGTTCCCCACTGCTGGGACAGGG - Intergenic
1105857489 13:24386026-24386048 GGCTCCCCACTGCTGGGAGAGGG - Intergenic
1106609393 13:31264056-31264078 GTGTCCCCTCATCTGGGAGAAGG + Intronic
1106943463 13:34800978-34801000 GGTCCCGCACAGATGGGACACGG - Intergenic
1106975247 13:35203993-35204015 GGGTCCCCACCCCTGGGCCATGG + Intronic
1107437825 13:40396106-40396128 GGGTCCCAACCCCTGGGCCATGG - Intergenic
1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG + Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1112294760 13:98177014-98177036 GGGCCTCCACAGCTGGCAGAAGG - Exonic
1113067627 13:106388012-106388034 GGGTTCATGCAGCTGGGACAAGG + Intergenic
1113324359 13:109267683-109267705 GGTCCCGCACAGATGGGACATGG - Intergenic
1113329124 13:109311625-109311647 GGCTCCTCACTTCTGGGACAGGG - Intergenic
1113735803 13:112678500-112678522 GGCTCCTCACTTCTGGGACAGGG + Intronic
1113793647 13:113044068-113044090 TGGCCCCCACAGCTGTGAAATGG + Intronic
1113946709 13:114048556-114048578 GGCTCCCCGCAGCTGGGATGCGG - Intronic
1114221699 14:20702918-20702940 GGTCCCGCACAGATGGGACATGG - Intergenic
1114268542 14:21087485-21087507 GGCTCCCAACAGCTCGGTCATGG + Intronic
1115240582 14:31248720-31248742 GGTCCCGCACAGATGGGACACGG + Intergenic
1116300488 14:43174879-43174901 GGGTAGCCACAGCTGGTAAAAGG + Intergenic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1116702383 14:48258759-48258781 GGTCCCGCACAGATGGGACACGG + Intergenic
1118188020 14:63555051-63555073 GGGTCCCCAACCCTGGGCCACGG - Intergenic
1118615552 14:67572377-67572399 GGGTCCCTAGAGCTGGGGGATGG + Intronic
1119420776 14:74506580-74506602 GGGTCCCCAGAGCATGGGCAAGG - Intronic
1119618092 14:76111923-76111945 GGGTGGCCACAGCTGGGCCCTGG - Intergenic
1120142155 14:80941482-80941504 AGGTCCCCACCCCTGGGACGAGG + Intronic
1121690727 14:95876042-95876064 GCATCCCCACTGCGGGGACAGGG + Intergenic
1122030014 14:98905338-98905360 GGAGCCTCACGGCTGGGACACGG - Intergenic
1122101275 14:99412275-99412297 GGTCCCCCACAGCTGGGAAGAGG - Intronic
1122363327 14:101180244-101180266 CGGTCCCAAGGGCTGGGACATGG - Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1122588146 14:102825489-102825511 AGGGCCCCACAGCTGGCCCAGGG - Intronic
1123006209 14:105325044-105325066 GGGTGCCCACAGCTTGGCCAGGG - Intronic
1123113603 14:105884004-105884026 GGGTCCAGACAGCTGTGCCAGGG + Intergenic
1123115826 14:105893643-105893665 GGGTCCAGACAGCTGTGCCAGGG + Intergenic
1123117854 14:105902753-105902775 GGGTCCAGACAGCTGAGCCAGGG + Intergenic
1123120068 14:105912358-105912380 GGGTCCAGACAGCTGTGCCAGGG + Intergenic
1202890604 14_KI270722v1_random:153756-153778 GGGTCCCCACCCCTGGGCCATGG + Intergenic
1123402806 15:20003944-20003966 GGGTCCAGACAGCTGTGCCAGGG + Intergenic
1123512143 15:21010598-21010620 GGGTCCAGACAGCTGTGCCAGGG + Intergenic
1123758270 15:23413892-23413914 CGCTCCCCAGAGCTGGGAGAAGG + Intergenic
1124512570 15:30339675-30339697 CGGTGCCCACAGCTGGGCCTTGG - Intergenic
1124593952 15:31078362-31078384 TAGTCCGCACAGCTGGGACTAGG - Intronic
1124730345 15:32191075-32191097 CGGTGCCCACAGCTGGGCCTTGG + Intergenic
1125003767 15:34795978-34796000 GGGTCCTGACAGCTGGGCCAGGG + Exonic
1125045798 15:35241105-35241127 GGTCCCGCACAGATGGGACACGG - Intronic
1125275097 15:37980406-37980428 GGCTCCCCACTGCCGGGAAATGG - Intergenic
1126912383 15:53430209-53430231 GGTCCCGCACAGATGGGACATGG + Intergenic
1127775583 15:62261997-62262019 GGGTCCCTCCAGCTGAGACCTGG + Intergenic
1127796347 15:62441712-62441734 CAGTCCCCACTGCTGGGAAAGGG + Intronic
1127865301 15:63027846-63027868 TGGACCCCACAGCTTGGACCAGG - Intergenic
1127876982 15:63120045-63120067 GGGTCCCAACCCCTGGGCCATGG - Intergenic
1128904442 15:71454470-71454492 GGAGCCCCACAGCTGGGAGAGGG - Intronic
1129176901 15:73846848-73846870 GGGTCCCTAAAGGTGGGAGAAGG + Intergenic
1129455449 15:75674204-75674226 GGGATCCCAAGGCTGGGACATGG - Intergenic
1129521902 15:76191520-76191542 GGGTCCCCCAGGCTGGGACGGGG + Intronic
1129878159 15:78990444-78990466 GGGGCCACACAGCTGCGACAAGG - Intronic
1129945927 15:79539316-79539338 GGGTCCACACAGCTGACAGAGGG - Intergenic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1132340435 15:101074872-101074894 GGTCCCGCACAGATGGGACACGG - Intronic
1132554494 16:566571-566593 GTGTCTCCACACCTGGGAGACGG - Intergenic
1132880285 16:2159111-2159133 GGGTCCCCACAGCTCGGCCAAGG - Intronic
1133031857 16:3014812-3014834 GGGTCTACATAGCTGGGACCTGG + Exonic
1133306665 16:4813828-4813850 GTGTCCCCACAGCTGGTGCTGGG - Exonic
1133537350 16:6714732-6714754 GCATCTACACAGCTGGGACATGG + Intronic
1133766742 16:8843456-8843478 GGTCCCGCACAGATGGGACACGG + Intronic
1133770352 16:8863992-8864014 AGCTCCCCACAGCTGGGGGAGGG + Intronic
1134046753 16:11106850-11106872 GGGTCACCACAGCTGGAAGGTGG + Intronic
1134066766 16:11233319-11233341 GGCTGCGCACAGCGGGGACAAGG + Intergenic
1134458068 16:14409002-14409024 TGCTCCCCAGAGCTGGGAGAAGG - Intergenic
1134584037 16:15395879-15395901 GGGCGCCCACAGCGCGGACATGG + Exonic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1136192256 16:28623479-28623501 GGGCGCCCACAGCGCGGACATGG - Exonic
1137694457 16:50452151-50452173 GGGTCCCAACAGCTAGCTCAAGG + Intergenic
1138521905 16:57575904-57575926 AGGTATCCACAGCTGTGACATGG + Exonic
1138615535 16:58162680-58162702 AAGTCCCCACAGCTGTGGCATGG + Intronic
1138759078 16:59521005-59521027 GGTCCCGCACAGATGGGACACGG + Intergenic
1141865183 16:86745398-86745420 GGTCCCGCACAGATGGGACACGG + Intergenic
1142114311 16:88348449-88348471 AGGTCCCCAGGGTTGGGACATGG + Intergenic
1143882032 17:10037002-10037024 GGGTTCACACAGCTGGGGCCGGG - Intronic
1144506629 17:15836998-15837020 GGCTCCCTCCACCTGGGACAGGG - Intergenic
1144950063 17:18989199-18989221 TGGTCCTCAGACCTGGGACAGGG - Intronic
1145076943 17:19863447-19863469 AGGTCCCCACAGCTCTCACATGG + Intronic
1146393293 17:32442653-32442675 GGGTCCCCAACCCTGGGCCAAGG + Intergenic
1148123819 17:45226815-45226837 GGGTCCCCACAGCTGGGACAAGG - Intronic
1149220527 17:54411793-54411815 GGTCCCTCACAGATGGGACATGG - Intergenic
1150634433 17:66902979-66903001 GGGACCCCAGAGCTAGCACATGG - Intergenic
1151497117 17:74464814-74464836 GGGATCCCATAGCTGGCACAGGG + Intergenic
1151539317 17:74757133-74757155 GGGTCTCCATGGCTGGCACAGGG + Intronic
1151568951 17:74916476-74916498 GGGCCCCCATGGCTGGGGCAGGG - Exonic
1151787122 17:76280470-76280492 AGGTCCCCGCATCTGGGAGATGG + Intronic
1151839732 17:76609328-76609350 GGTCCCGCACAGATGGGACACGG + Intergenic
1151930688 17:77229849-77229871 ATGTGCCCACAGCTGGGACAAGG + Intergenic
1152722290 17:81928945-81928967 AGGTCCACACAGCGGGGACCTGG + Intergenic
1152811027 17:82382934-82382956 GGACCCCCACACCTGGGTCAGGG - Intergenic
1152994359 18:392581-392603 GGGTCCAGAAAGCTGGGACAAGG - Intronic
1153768581 18:8397627-8397649 GGGTCCCCAGAGGATGGACAAGG + Intronic
1154497775 18:14975065-14975087 GAGTCCCCACAGCAGGGGCTGGG - Intergenic
1155696995 18:28696474-28696496 GGTCCCGCACAGATGGGACACGG + Intergenic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1156372481 18:36483952-36483974 GTGTCCCCACAGCTGGTGAATGG - Intronic
1157224794 18:45853011-45853033 AGGACCCCACAGGTGGGACTGGG - Intronic
1158185825 18:54770177-54770199 GGTTGCCAACACCTGGGACATGG + Intronic
1159164487 18:64683977-64683999 GGTCCCGCACAGATGGGACATGG - Intergenic
1159785584 18:72710478-72710500 GGGTCTCCACAGCCATGACAGGG - Intergenic
1160272185 18:77397234-77397256 AGCTCTCCACAGCAGGGACATGG - Intergenic
1160537820 18:79604336-79604358 GGGCCTCCAGAGCTGGGAGAGGG - Intergenic
1160741252 19:687102-687124 GGCCCCCCACAGCGGGGACACGG - Exonic
1160799320 19:960477-960499 GGGTCCCCACTACTGGGTAATGG + Intronic
1160910983 19:1473703-1473725 TTGTCCCCCCAGCTGGGCCAGGG - Exonic
1161793917 19:6375788-6375810 CTGTCCCTGCAGCTGGGACAGGG - Exonic
1161951277 19:7469429-7469451 GGATCAGCACAGCCGGGACAGGG + Intronic
1161994907 19:7706142-7706164 GAACCCCCACACCTGGGACAGGG + Intergenic
1162094345 19:8301877-8301899 GGGTCCCCAGACCTGGGAATGGG + Intronic
1162262232 19:9542572-9542594 GGGGTCCCACAGATGGGACATGG - Intergenic
1163204086 19:15789597-15789619 GGGAGCCCTCAGCTGGGAGAAGG + Intergenic
1163409552 19:17145506-17145528 GGGTCCCCACTGGTGGGAGCTGG + Intronic
1163475071 19:17521091-17521113 GGGACGCCGCAGCTGGGACCAGG + Exonic
1163532044 19:17855721-17855743 GGGCCACCGCAGATGGGACATGG + Intergenic
1163944431 19:20522454-20522476 GGTCCCGCACAGATGGGACATGG + Intergenic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1164459204 19:28433236-28433258 GGTCCCCCACAGATGGGACATGG + Intergenic
1165223669 19:34338707-34338729 AAGGCCTCACAGCTGGGACAAGG + Intronic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1166873002 19:45882289-45882311 GGGTCTGCAGAGCTGGGTCAGGG + Intergenic
1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG + Intergenic
1167435015 19:49474327-49474349 GGGTCCCCACTCCTGGGGCAGGG + Intronic
1167646938 19:50711008-50711030 GGGAGCCCACATCTGGGACTGGG - Intronic
1167665180 19:50819468-50819490 GGATTCCCACAGAGGGGACAGGG + Intronic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1168227965 19:55010157-55010179 GGTCCCGCACAGATGGGACACGG + Intergenic
1168301951 19:55409949-55409971 GGGGTTCCCCAGCTGGGACAAGG + Intergenic
1202666027 1_KI270708v1_random:120594-120616 GGGTCCCCACCCCTGGGCCATGG + Intergenic
925556559 2:5137182-5137204 AGGTCCCCAGGGTTGGGACAAGG - Intergenic
925675842 2:6360301-6360323 GCATCTCCACTGCTGGGACAGGG + Intergenic
926197841 2:10774470-10774492 CCGTCACCACAGCTGGCACAGGG - Intronic
926286867 2:11495673-11495695 GAGTCCACACACCTGGGAGATGG + Intergenic
927486458 2:23491610-23491632 GGATTCCCACTGCTGGGACAGGG - Intronic
928098994 2:28423804-28423826 GGGTACCCAGAGCTGGGCAAAGG - Intergenic
928770199 2:34696189-34696211 GGTCCCGCACAGATGGGACACGG - Intergenic
928857193 2:35815417-35815439 GGTCCCGCACAGATGGGACATGG - Intergenic
928928586 2:36601372-36601394 GGTCCCGCACAGATGGGACACGG - Intronic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
929793043 2:45037809-45037831 GGTCCCGCACAGATGGGACATGG + Intergenic
930026380 2:47031688-47031710 GGGCCCCCTCAGCTGGAACTGGG - Intronic
930030921 2:47057499-47057521 GGGTCCCCAAGGGAGGGACAAGG + Intronic
930090308 2:47527043-47527065 AAGTCCCCACAGCTTGGAAATGG + Intronic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931026371 2:58116789-58116811 GGTCCCGCACAGATGGGACACGG + Intronic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
932358798 2:71088417-71088439 GGTCCCGCACAGATGGGACACGG + Intergenic
933079290 2:77967446-77967468 GGTCCCGCACAGATGGGACATGG - Intergenic
933137956 2:78760234-78760256 GGTCCCTCACAGATGGGACATGG - Intergenic
933552371 2:83792283-83792305 GGTCCCGCACAGATGGGACACGG + Intergenic
934227957 2:90150288-90150310 GGTCCCGCACAGATGGGACACGG + Intergenic
935175112 2:100642482-100642504 GGGCTCCCAAAGCTGGGCCAAGG + Intergenic
935335686 2:102013874-102013896 GAGTCCCCACAGTGGGGACGAGG + Intronic
936935532 2:117835693-117835715 GAGTGTCCACAGCTGGGAAAGGG + Intergenic
939152968 2:138494797-138494819 GGGTCCTCAGAGGTGGAACAAGG + Intergenic
940136709 2:150445308-150445330 GTTTCCCCCAAGCTGGGACAAGG + Intergenic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
940508767 2:154586611-154586633 GGTCCCGCACAGATGGGACATGG + Intergenic
940530209 2:154869658-154869680 GGTCCCGCACAGATGGGACACGG - Intergenic
941340421 2:164298192-164298214 GGTCCCGCACAGATGGGACACGG - Intergenic
942502632 2:176607546-176607568 GGGTCCCAACACCTGAGCCATGG - Intergenic
943412910 2:187563852-187563874 GGTCCCACACAGTTGGGACACGG + Intronic
943421564 2:187673851-187673873 GGTCCCGCACAGATGGGACATGG + Intergenic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
946529218 2:220553425-220553447 GGAGCCCCACAGCTGGGAAGTGG - Intergenic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
946871735 2:224091224-224091246 GGTCCCGCACAGATGGGACATGG + Intergenic
948220570 2:236266135-236266157 GGGGCCCCAGAGCTGGGGCAGGG - Intergenic
948564853 2:238878242-238878264 GGGCCCCCACTGGTGGCACAGGG - Intronic
948887951 2:240893249-240893271 GGGTCCACACAGCCAGGACCAGG - Intronic
948894626 2:240922407-240922429 GGGGCCCCACAGCAGGGGCTGGG - Intronic
1168836750 20:882591-882613 GGGTGCCAACAGGTGGGGCAGGG - Intronic
1168878418 20:1186072-1186094 GAGGCCCCACAGCTGGGCCTTGG - Intronic
1169194173 20:3674497-3674519 TGGTCCCCAGAGCAGGGTCAGGG - Exonic
1170680413 20:18520971-18520993 GGTCCCGCACAGATGGGACACGG + Intronic
1170820681 20:19754519-19754541 GGTCCCGCACAGATGGGACACGG + Intergenic
1171044339 20:21796553-21796575 GGGTCCCCAGTGCTGGAGCATGG - Intergenic
1171430713 20:25081849-25081871 GGGGCCCTACCGCTGGGACTCGG - Exonic
1171464449 20:25317844-25317866 CCGACCCCACAGCAGGGACATGG + Intronic
1172098598 20:32472826-32472848 TGGACACCAGAGCTGGGACAGGG - Intronic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1173631311 20:44518139-44518161 GGGTCGCTACAGCTGTGAGATGG - Intronic
1174606799 20:51767623-51767645 GGAATCCCACGGCTGGGACAGGG - Intronic
1175084717 20:56448585-56448607 GGCTCTCCTCAGCTGGGAAATGG - Intronic
1175519637 20:59591777-59591799 GGCTCCCCGCAGCAGGGCCAAGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176086087 20:63296204-63296226 TGGTCCCCTCAGCTCAGACAGGG + Intronic
1176180338 20:63746847-63746869 GGGTCTCCACTGCGGGGCCAGGG - Exonic
1176206533 20:63891673-63891695 AGGTCCTCAATGCTGGGACAAGG + Intergenic
1176261964 20:64186646-64186668 GGGTCCCCAAAGCTCACACAGGG - Intronic
1176515521 21:7780740-7780762 GGGTCCCATCAGCAGGGTCATGG - Intergenic
1177102696 21:16916325-16916347 GGTCCCGCACAGATGGGACATGG - Intergenic
1178492316 21:33060583-33060605 GGATCCCCAGTGCTTGGACAGGG - Intergenic
1178649549 21:34410752-34410774 GGGTCCCATCAGCAGGGTCATGG - Intergenic
1179545012 21:42107893-42107915 CTGGCCCCGCAGCTGGGACAAGG - Intronic
1179584851 21:42367970-42367992 GGGTCTCCACTCCTGGGCCAGGG + Intergenic
1179655287 21:42841236-42841258 GGGTCCCCACAGAGGAGGCAGGG - Intergenic
1181010127 22:20035392-20035414 CAGTGCTCACAGCTGGGACATGG - Intronic
1181449751 22:23011634-23011656 GGGTTGTCACAGCTGGGCCAGGG + Intergenic
1183667790 22:39255225-39255247 GGGTCCTCAGCGCTGGGACAGGG - Intergenic
1184316678 22:43698681-43698703 GGGCCACCACAGCTGGGTTAAGG - Intronic
1184386188 22:44175919-44175941 TGGTCCTAACAGCCGGGACATGG + Intronic
1184423890 22:44397696-44397718 AGGTCCCCACAGCCAGCACAGGG - Intergenic
1184490052 22:44803251-44803273 TGGGCTCCACAGCTGGTACAGGG + Intronic
1184710813 22:46248341-46248363 GGGTCTTCATAGCTGGGAAAGGG - Intronic
1184787754 22:46680082-46680104 GGGTACCCAGGGCTGGCACAGGG + Intergenic
1185048574 22:48541528-48541550 GGCTCCTCACACCTGGGACAAGG - Intronic
1185248293 22:49785218-49785240 GGGAGCCCACAGCTGGGGCAGGG + Intronic
949875058 3:8621206-8621228 GGGTCCCCACATCTGAGTCTGGG - Intronic
950079430 3:10210600-10210622 GTGACACCACACCTGGGACATGG - Intronic
950098247 3:10342547-10342569 GGTTAGCCAGAGCTGGGACAGGG + Intronic
950486433 3:13276652-13276674 GGGTCCCCAGAGCAAGGCCAAGG + Intergenic
951332306 3:21381936-21381958 GGTCCCGCACAGATGGGACATGG + Intergenic
951921770 3:27862527-27862549 GGCATCCCACAGCTGGGATAAGG + Intergenic
952663434 3:35877698-35877720 GGTCCCGCACAGATGGGACATGG + Intergenic
953352060 3:42223137-42223159 CGACCCCCAGAGCTGGGACAGGG + Exonic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
953656545 3:44859056-44859078 GGTCCCGCACAGTTGGGACACGG + Intronic
953698689 3:45179559-45179581 GGGACCACACAGCTGTGAAAGGG + Intergenic
953880642 3:46689646-46689668 GGGACCCCTCAGCTGGGCCTAGG - Intronic
953967899 3:47324119-47324141 GGCATCCCACAGCAGGGACAAGG - Intronic
954755104 3:52834928-52834950 GGGTCCTCCTACCTGGGACATGG + Exonic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
957459080 3:80494255-80494277 GGGTCCCCAACACTGGGACGTGG + Intergenic
957985709 3:87571693-87571715 GGTCCCGCACAGATGGGACATGG - Intergenic
958421976 3:93940137-93940159 GGTTCTGCACAGATGGGACATGG - Intronic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
960096865 3:113697362-113697384 GGGGCCTCCCAGCTGGGACAAGG + Intergenic
960937162 3:122911359-122911381 GGGTCCCCACTGCTTTGAGATGG - Intronic
961079853 3:124016978-124017000 GGGTGGGCAGAGCTGGGACATGG - Intergenic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961314660 3:126026307-126026329 GGGGGCTCACAGCTGGGGCATGG + Intronic
961628401 3:128279388-128279410 TGGTCATCACAGCTGGGAGAGGG - Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
961730607 3:128962042-128962064 GGTCCCGCACAGATGGGACACGG - Intronic
961881065 3:130061609-130061631 GGTTCCGCACAGATGGGACGTGG - Intergenic
962205586 3:133431465-133431487 GGTCCCGCACAGATGGGACACGG - Intronic
962366894 3:134792885-134792907 GTGTTCCCACAGCTAGAACAGGG + Intronic
962752466 3:138443912-138443934 GGGTCCACACAGATGGGTCTGGG - Intronic
963058644 3:141207300-141207322 GGTCCCGCACAGATGGGACATGG - Intergenic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
965624862 3:170675896-170675918 GGTCCCGCACAGATGGGACATGG + Intronic
965640019 3:170821332-170821354 GGTCCCGCACAGATGGGACATGG + Intronic
966085450 3:176063671-176063693 GGTCCCGCACAGATGGGACATGG - Intergenic
967005338 3:185377906-185377928 GGTCCCGCACAGATGGGACATGG + Intronic
967624632 3:191669862-191669884 GGTCCCGCACAGATGGGACACGG + Intergenic
967821374 3:193842356-193842378 GGCTCCACACAGAGGGGACAGGG + Intergenic
969749076 4:9096595-9096617 GGTCCCGCACAGATGGGACATGG - Intergenic
970384613 4:15543670-15543692 TGGACCCCACAGCAGGGGCAGGG - Intronic
970396455 4:15672196-15672218 GGTTTCCCACAGCTGAGGCAAGG + Intronic
970411230 4:15809712-15809734 GGGTGCCTGCAGTTGGGACAGGG - Intronic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
971180581 4:24325546-24325568 GGTCCCGCACAGATGGGACAAGG - Intergenic
971552673 4:27976300-27976322 GGTCCCCCACAGATGCGACACGG - Intergenic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
977198411 4:94088002-94088024 GGTCCCGCACAGATGGGACACGG + Intergenic
977225325 4:94386846-94386868 GGTCCCGCACAGATGGGACATGG + Intergenic
977926371 4:102705154-102705176 GGCTCCCCAATGCTGGGAGAAGG + Intronic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
979372036 4:119900600-119900622 GTGTCGCCAAAGCTAGGACAAGG - Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
982083948 4:151815980-151816002 GGTCCCGCACAGTTGGGACACGG + Intergenic
982497089 4:156106844-156106866 GGTCCCGCACAGATGGGACACGG + Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983055507 4:163095421-163095443 GGTCCCGCACAGATGGGACACGG - Intergenic
983126884 4:163964058-163964080 GGGACCCCAGAGCTCGAACAGGG + Intronic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
983448075 4:167878584-167878606 GGTCCCGCACAGATGGGACACGG - Intergenic
983905124 4:173173661-173173683 GGGTCCCCAACCCTGGGTCATGG - Intronic
984393596 4:179168267-179168289 GGTCCCGCACAGATGGGACACGG + Intergenic
984466224 4:180101997-180102019 GGCTCCCCACTGCCGGGAAACGG - Intergenic
984700690 4:182816855-182816877 GGTCCCGCACAGATGGGACACGG - Intergenic
984896629 4:184547317-184547339 AGGTGCACACAGCTGGGACCTGG - Intergenic
985887152 5:2688578-2688600 GGGTCCCCCCTAGTGGGACAAGG - Intergenic
986125265 5:4878424-4878446 GGGTCCCCACCCCTGGAACTTGG + Intergenic
986152346 5:5139781-5139803 GTGTCCCCACAGCTGTGCCCGGG + Intergenic
986193553 5:5517888-5517910 GGTCCCGCACAGATGGGACATGG - Intergenic
986197958 5:5555248-5555270 GGGTCCCAACCCCTGGGCCATGG + Intergenic
986335981 5:6755729-6755751 GGGGCCCGACAGCAGGGCCACGG - Exonic
986905791 5:12492134-12492156 GGTCCCGCACAGATGGGACACGG - Intergenic
988199116 5:28047972-28047994 GGTCCCGCACAGATGGGACATGG - Intergenic
989680871 5:44028413-44028435 GGGGCCCCAAAGCTGGGATATGG + Intergenic
989688884 5:44118112-44118134 GGTCCTGCACAGCTGGGACATGG + Intergenic
991365602 5:65864813-65864835 GGGTCCCAACCTCTGGGCCATGG - Intronic
992451984 5:76883761-76883783 GGTCCCGCACAGATGGGACATGG + Intronic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
993010199 5:82473433-82473455 AAGTCCCCAGAGCTGTGACATGG + Intergenic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
994989572 5:106980713-106980735 GGTCCCGCACAGATGGGACACGG - Intergenic
995899349 5:117049742-117049764 GGTCCCGCACAGATGGGACATGG + Intergenic
996912424 5:128670598-128670620 GGTCCCGCACAGATGGGACATGG + Intronic
997304334 5:132826816-132826838 AGGGCCACACAGCTGGGACGTGG + Intronic
997352998 5:133244221-133244243 GGGGCCCCACAGCAGGGGCTGGG + Intronic
997359877 5:133288327-133288349 GGGTCCCCCATGGTGGGACAGGG + Intronic
997678843 5:135735052-135735074 GGTCCCGCACAGATGGGACACGG + Intergenic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
999734022 5:154499164-154499186 GGTTTCTCACAGCTGGGGCAGGG - Intergenic
1000572904 5:162936731-162936753 GGCTCCCCAGAGCAGGGAAAGGG - Intergenic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1001331433 5:170765411-170765433 GGTCCCGCACAGATGGGACACGG + Intronic
1001892189 5:175348886-175348908 GGTTCTCCACACCTGGGAGAAGG - Intergenic
1003130039 6:3387580-3387602 CGGTCCCCAGAGCTGAGAAACGG - Intronic
1004106286 6:12669710-12669732 GGTCCCGCACAGATGGGACATGG - Intergenic
1004275672 6:14233300-14233322 GGGTCCCAGCAGATGGCACATGG - Intergenic
1004858986 6:19781765-19781787 AGGTCACCACAGCTGGAGCAGGG - Intergenic
1006174299 6:32112694-32112716 TGGCCCCCACAGCTGGGAAGAGG + Intronic
1006284429 6:33081757-33081779 GGTTCCCCACGGCTGTCACAGGG + Intronic
1006911529 6:37566493-37566515 GGGCGCCCACAGCCGGGGCATGG - Intergenic
1006915532 6:37591501-37591523 GGGTCCGCAAAGGTGGGCCAGGG + Intergenic
1007627491 6:43254693-43254715 GGGTCCCCAGATCTGGGAGTAGG - Intronic
1007783045 6:44265083-44265105 GGGGCCCCCCAGCAAGGACAGGG + Exonic
1007994450 6:46291428-46291450 TGGTTCCCACCGCTGGGACTCGG - Intronic
1010071705 6:71751925-71751947 GGTCCCGCACAGATGGGACACGG + Intergenic
1010662332 6:78585727-78585749 GGTCCCGCACAGATGGGACACGG - Intergenic
1010826894 6:80485815-80485837 GGTCCCGCACAGATGGGACACGG + Intergenic
1010829672 6:80513683-80513705 GGGTCTGCACAGATGGGACGTGG + Intergenic
1010841294 6:80651175-80651197 GGTCCCGCACAGATGGGACATGG + Intergenic
1010894527 6:81348515-81348537 GGTCCCGCACAGATGGGACACGG + Intergenic
1011367880 6:86601748-86601770 GGTCCCGCACAGATGGGACATGG + Intergenic
1014891562 6:126851086-126851108 GGTCCCGCACAGATGGGACATGG - Intergenic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1016650273 6:146453793-146453815 GGTCCCGCACAGATGGGACATGG + Intergenic
1017980717 6:159399081-159399103 GGAACCACACAGCAGGGACAGGG + Intergenic
1018185041 6:161259656-161259678 GGGACCCCACAGTTGGGGTAAGG - Intronic
1018686623 6:166308415-166308437 GGGTCCCCACAGCTGAGACGCGG + Intronic
1018729475 6:166637826-166637848 CGGCCCCCACGGCTGAGACACGG - Intronic
1019075093 6:169380583-169380605 GGGGCCCCACTGCTGGGCTAAGG - Intergenic
1019282578 7:207835-207857 GGGTTCCCACAGCAGGGAAGGGG - Intronic
1019522134 7:1465848-1465870 GGGCCTCCAGAGCTGGGATACGG - Intergenic
1019564420 7:1672325-1672347 GGCTCCCCACACCTGGGCCAGGG + Intergenic
1019684147 7:2371239-2371261 GCGTTCCCACAGCTGGTCCACGG + Intronic
1020027816 7:4911356-4911378 GTGACTCCACGGCTGGGACATGG + Intronic
1021197948 7:17693283-17693305 TGGTTGCCACAGCTGGGAAAAGG - Intergenic
1021637335 7:22705576-22705598 GGTCCCGCACAGATGGGACACGG - Intergenic
1021810680 7:24398609-24398631 GGTCCCGCACAGATGGGACATGG - Intergenic
1021977877 7:26027565-26027587 GGTCCCGCACAGATGGGACATGG + Intergenic
1022293964 7:29032314-29032336 GGGCCCCCACTGCAGGAACACGG + Intronic
1022372891 7:29787179-29787201 GGTCCCGCACAGATGGGACACGG - Intergenic
1022572773 7:31470405-31470427 GGTCCCGCACAGATGGGACATGG + Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1023698867 7:42873985-42874007 GGTCCCGCACAGATGGGACATGG + Intergenic
1023715472 7:43039497-43039519 GGGTGCCAGCAGCTGGGATATGG + Intergenic
1023867330 7:44244424-44244446 GAGACCCCACCGCTGGGAGATGG - Intronic
1023888120 7:44375163-44375185 GGGTCCCCTCAGAGGGGAGAGGG - Intergenic
1023951213 7:44847799-44847821 CGGGCTCCGCAGCTGGGACATGG + Intronic
1024226139 7:47328097-47328119 GGGACGCCACCGCTGGGACAGGG - Intronic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1029087217 7:98021101-98021123 GGGTCTCCTCAGCTGTGAAAAGG + Intergenic
1030927118 7:115472107-115472129 GAGTGCCCACATCTGGGCCATGG - Intergenic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1033088577 7:138364882-138364904 GGTCCCGCACAGATGGGACATGG - Intergenic
1034084813 7:148313428-148313450 GGTCCCGCACAGATGGGACATGG + Intronic
1034256766 7:149728986-149729008 GGGTCCACGCAGCTGGGTCTGGG + Intronic
1034334143 7:150309686-150309708 GGTCCCGCACAGGTGGGACACGG - Intronic
1034727400 7:153350483-153350505 GTGTCCCCACAGCAGTGTCATGG - Intergenic
1035052236 7:156005545-156005567 GGCCCCCCACAGCAGGGAGAAGG + Intergenic
1035856119 8:2978273-2978295 TGGTCCACACAGCTCAGACACGG - Intronic
1035897998 8:3425636-3425658 GGCTCCCTGCTGCTGGGACAGGG - Intronic
1036147839 8:6270857-6270879 GGCTCCACACAGGTGGGGCACGG + Intergenic
1036692239 8:10951308-10951330 GGGCCCCCACAGTGGTGACAGGG + Intronic
1037566139 8:20119978-20120000 GGCTCCTCCCAGCTGGGACAGGG - Intergenic
1037786412 8:21905982-21906004 GGGTCCACACATCTGGGAGTGGG + Intergenic
1037878984 8:22563883-22563905 TAGACCCCACAGCAGGGACAAGG + Intronic
1039498983 8:38002055-38002077 GGCCCCGCACAGATGGGACATGG + Intergenic
1040976474 8:53199011-53199033 GGGACCCCAGAGGTGGGAGATGG + Intergenic
1041586878 8:59530940-59530962 GTGTCCCCAAAGCTGGGATTTGG - Intergenic
1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG + Intergenic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043717879 8:83508519-83508541 GGTCCCGCACAGATGGGACACGG + Intergenic
1044258597 8:90093582-90093604 GGTCCCGCACAGATGGGACATGG + Intronic
1044417102 8:91950300-91950322 GGTCCCGCACAGATGGGACACGG - Intergenic
1044738524 8:95302701-95302723 GGTTCCTCAAAGCTGAGACAGGG - Intergenic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1046294137 8:112198155-112198177 GGTTCCACAAAGATGGGACATGG - Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1047829526 8:128615286-128615308 GGTCCCGCACAGATGGGACACGG + Intergenic
1048240351 8:132735238-132735260 GTGTCAACACAGCTGGGAAAGGG + Intronic
1048335408 8:133498756-133498778 GGGACCCCACAGCAGGGCCCAGG - Intronic
1049181030 8:141222306-141222328 GGGTCCCCACAGCCAGCAAAAGG + Intronic
1049206688 8:141366836-141366858 GGGTGCCCAGAGCTGGGTCTTGG - Intronic
1049221366 8:141430284-141430306 GGGTCCTTACAGCGGGGACCCGG - Intronic
1049221381 8:141430335-141430357 GGGTCCTTACAGCGGGGACCTGG - Intronic
1049868799 8:144957637-144957659 GGTCCCGCACAGATGGGACATGG + Intergenic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1051849267 9:21489079-21489101 GGTCCCGCACAGATGGGACACGG + Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1053380377 9:37644504-37644526 GGGTCCCCTCAGCAGGGAGCTGG + Intronic
1055347697 9:75355158-75355180 GGTCCCGCACAGATGGGACACGG + Intergenic
1055499603 9:76889766-76889788 GGGGCTGCACAGCTGGGAGAAGG - Intronic
1055626741 9:78183140-78183162 GGTCCCGCACAGATGGGACACGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056435150 9:86568724-86568746 GGGTCTCAACAGCTGGGGGATGG + Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1059459589 9:114421284-114421306 GAGCCCCCTGAGCTGGGACAAGG + Intronic
1060737860 9:126078005-126078027 GGTCCCCCACAGATGGGACACGG + Intergenic
1061363448 9:130158000-130158022 GGGTCGACACAGCAGGAACAAGG - Intergenic
1061541276 9:131278848-131278870 AGGTGCCCACAGCCGGCACAGGG + Intergenic
1061583090 9:131549419-131549441 GGTCCCGCACAGATGGGACATGG - Intergenic
1062077043 9:134595144-134595166 GGGCCCCAACAGCTGGGGCAAGG - Intergenic
1062187905 9:135228422-135228444 CTGACCCCACAGCTGGGAGAAGG - Intergenic
1062247360 9:135576074-135576096 GGGCCCCCACAGCTGTGTCCAGG + Intergenic
1203487700 Un_GL000224v1:72861-72883 GGGTCCCCACCCCTGGGCCATGG + Intergenic
1203500321 Un_KI270741v1:14756-14778 GGGTCCCCACCCCTGGGCCATGG + Intergenic
1185858410 X:3556501-3556523 GGTCCCGCACAGATGGGACACGG + Intergenic
1185960672 X:4543861-4543883 GGTCCCGCACAGATGGGACACGG + Intergenic
1185991079 X:4893925-4893947 GGTCCCGCACAGATGGGACACGG - Intergenic
1186784088 X:12942156-12942178 GGTCCCGCACAGATGGGACACGG - Intergenic
1187506628 X:19883596-19883618 AGGCACCCACAGCTGGGCCAGGG + Intronic
1188552673 X:31379838-31379860 GGTCCTCCACAGATGGGACATGG - Intronic
1189031793 X:37459145-37459167 GGTCCCGCACAGATGGGACATGG + Intronic
1189310490 X:40014336-40014358 GGGTGCGCTCAGCCGGGACAAGG - Intergenic
1190625720 X:52336747-52336769 GGGTCCCCACAGAAGGGACTAGG + Intergenic
1190736056 X:53256566-53256588 GGCCTCACACAGCTGGGACAGGG - Intronic
1191841197 X:65514640-65514662 GGCTCCCCACACTAGGGACAGGG + Intronic
1192941681 X:75919779-75919801 GGGTCCCCACTGTGGGGAAATGG + Intergenic
1193885947 X:86984139-86984161 GGTCCCGCACAGATGGGACAAGG - Intergenic
1194186230 X:90776694-90776716 GGTCCCGCACAGATGGGACACGG + Intergenic
1195016931 X:100789796-100789818 GGTCCCGCACAGATGGGACATGG + Intergenic
1195334101 X:103832315-103832337 GGGTCCCCACCGCCGAGAAAGGG - Intergenic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1195908659 X:109868591-109868613 GGTCCCGCACAGATGGGACACGG + Intergenic
1196220963 X:113112094-113112116 GGTCCCGCACAGATGGGACATGG + Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1196572517 X:117281493-117281515 GGTCCCGCACAGATGGGACATGG - Intergenic
1196773836 X:119321141-119321163 GGTCCCGCACAGATGGGACATGG + Intergenic
1196893087 X:120309149-120309171 GGGTTTCCACAGTTTGGACAGGG - Intronic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197623729 X:128780652-128780674 GGCTCCCCGCAGCGGGGAAATGG + Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1199989266 X:152976077-152976099 GGGCCCCCACGTCTGGCACATGG - Intergenic
1200532820 Y:4358773-4358795 GGTCCCGCACAGATGGGACATGG + Intergenic
1200631279 Y:5590704-5590726 AGGTCCCCATATCTAGGACATGG - Intronic