ID: 1148124741

View in Genome Browser
Species Human (GRCh38)
Location 17:45230890-45230912
Sequence TGTGAGTCACTAGCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148124732_1148124741 6 Left 1148124732 17:45230861-45230883 CCCTTTCTCTTGAACTCCCCAAA 0: 1
1: 0
2: 3
3: 44
4: 415
Right 1148124741 17:45230890-45230912 TGTGAGTCACTAGCAGGGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 217
1148124734_1148124741 -10 Left 1148124734 17:45230877-45230899 CCCCAAAAGACCTTGTGAGTCAC 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1148124741 17:45230890-45230912 TGTGAGTCACTAGCAGGGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 217
1148124731_1148124741 12 Left 1148124731 17:45230855-45230877 CCAAATCCCTTTCTCTTGAACTC 0: 1
1: 0
2: 1
3: 26
4: 276
Right 1148124741 17:45230890-45230912 TGTGAGTCACTAGCAGGGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 217
1148124730_1148124741 13 Left 1148124730 17:45230854-45230876 CCCAAATCCCTTTCTCTTGAACT 0: 1
1: 0
2: 4
3: 30
4: 348
Right 1148124741 17:45230890-45230912 TGTGAGTCACTAGCAGGGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 217
1148124733_1148124741 5 Left 1148124733 17:45230862-45230884 CCTTTCTCTTGAACTCCCCAAAA 0: 1
1: 0
2: 0
3: 21
4: 307
Right 1148124741 17:45230890-45230912 TGTGAGTCACTAGCAGGGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148124741 Original CRISPR TGTGAGTCACTAGCAGGGCT GGG Intronic
901162792 1:7192772-7192794 TGTGAGTCAATGACAGGGTTAGG + Intronic
904255267 1:29250734-29250756 GTTGAGTCTCTAGCAGAGCTGGG + Intronic
905734125 1:40314669-40314691 TGAGACCCACTACCAGGGCTGGG + Intronic
906611828 1:47209106-47209128 TTTGAGTCTTGAGCAGGGCTAGG + Intergenic
906658450 1:47565704-47565726 AGGGAGCCAATAGCAGGGCTGGG - Intergenic
906736809 1:48137635-48137657 TGTGAGGCAGCAGCAAGGCTGGG - Intergenic
907050873 1:51329496-51329518 TGTGTGGCTCTATCAGGGCTTGG - Intronic
907304172 1:53504732-53504754 TGGGAGTAAGTAGCAGGGTTTGG + Intergenic
907549501 1:55292331-55292353 TCAGAGCCACTAGGAGGGCTGGG + Intergenic
909315909 1:74218658-74218680 GGTGAGTTAATAGCAGTGCTAGG - Intronic
911743410 1:101412204-101412226 TCTAAGTCTCTAGCAAGGCTGGG - Intergenic
912004176 1:104876433-104876455 TGTGAATAGTTAGCAGGGCTTGG - Intergenic
915249359 1:154577426-154577448 CATGAGTTACTAGCAGGGCCAGG - Exonic
915679617 1:157567944-157567966 GGTGAGACCCTAGCAGGCCTTGG - Intergenic
916049828 1:161028524-161028546 TATGATTCATTAGCTGGGCTTGG - Intronic
916128261 1:161590109-161590131 AGTGAGTCATTTCCAGGGCTAGG - Intronic
916138181 1:161671940-161671962 AGTGAGTCATTTCCAGGGCTAGG - Intronic
916530720 1:165653808-165653830 AGTCAGTCACTGGCAGGGCTGGG - Intronic
918012276 1:180598463-180598485 TGTGAAATACTGGCAGGGCTTGG + Intergenic
920725220 1:208428579-208428601 TAGGAATCACCAGCAGGGCTTGG + Intergenic
920726822 1:208444284-208444306 TCTGGGTCTCTAGCAAGGCTGGG + Intergenic
920995736 1:210988929-210988951 TGTGTGTCTCTATCATGGCTTGG + Intronic
923349903 1:233093756-233093778 TGGGTGTCACTAACAGGGCCAGG + Intronic
1064130286 10:12703361-12703383 TGGGTCTCACTCGCAGGGCTCGG + Intronic
1064907993 10:20369048-20369070 TCTAAGTCTCTAGCAAGGCTGGG + Intergenic
1065693140 10:28355586-28355608 TGTGAGGCAAGAGCAGGGATTGG + Intergenic
1070144263 10:73762287-73762309 AGTGAGTATCTAGAAGGGCTAGG - Intronic
1070766916 10:79062055-79062077 TATGAGACAGCAGCAGGGCTGGG - Intergenic
1071516898 10:86304053-86304075 AGAGAGTCACTACCAGGGTTGGG - Intronic
1072095853 10:92178758-92178780 TGTAAGTCACCAGATGGGCTGGG + Intronic
1072740752 10:97907718-97907740 TGAGAGACACAAGCAGGACTTGG + Intronic
1073900330 10:108213966-108213988 TCTAAGTCTCTAGCAAGGCTGGG + Intergenic
1074424981 10:113342764-113342786 AGTGAGTCACGAGCAGGGCCAGG - Intergenic
1076675953 10:132147809-132147831 TGTGAGGCGCTTCCAGGGCTGGG + Intronic
1077376653 11:2208429-2208451 TGTGAGTCACAGGTAGGGCCTGG - Intergenic
1077401472 11:2360210-2360232 TGGCAGTCCCTTGCAGGGCTGGG + Intergenic
1077467186 11:2738940-2738962 TGTCACTCACCAGCAGGGTTGGG + Intronic
1078688036 11:13551006-13551028 TGTGAGTGAATGGCAGAGCTAGG - Intergenic
1079246924 11:18759395-18759417 TGTTGGTCAATAGCAGAGCTGGG + Intronic
1080132457 11:28813006-28813028 ATTGAGGCATTAGCAGGGCTGGG + Intergenic
1082007533 11:47428067-47428089 AGTGAGTCACTGGCAGCACTAGG + Intergenic
1082028899 11:47590905-47590927 TGTGGGTCAAGGGCAGGGCTGGG - Intronic
1083994300 11:66264640-66264662 TGTGAGGCCCTAGCAGGCCAAGG - Intronic
1084494341 11:69495408-69495430 TGTGAGTATCTAGCAGGGGCTGG - Intergenic
1087235973 11:95719050-95719072 CTTAAATCACTAGCAGGGCTTGG - Intergenic
1088755425 11:112881714-112881736 CGCGAGTGACTGGCAGGGCTGGG - Intergenic
1089789302 11:120931140-120931162 TGTTAGTAACTGGCAGGGCGAGG + Intronic
1091079379 11:132652516-132652538 AGTGAGTAAGTAGCAGAGCTGGG - Intronic
1092104547 12:5912336-5912358 AGTGGGTGAGTAGCAGGGCTGGG - Intronic
1094717933 12:33032218-33032240 TCTAAGTCTCTAGCAAGGCTGGG + Intergenic
1095732841 12:45523583-45523605 TCTGGGTCTCTAGCAAGGCTGGG - Intergenic
1095876351 12:47083026-47083048 TGTGAGTGTCTAGCTGGGTTTGG + Intronic
1101269012 12:103123185-103123207 TGTGGGTCACTAGCATTGCAAGG - Intergenic
1101732239 12:107436368-107436390 TGGGAGTGACAAGCTGGGCTTGG + Intronic
1101876328 12:108598762-108598784 GGTGAGTCAGTGGCAGGCCTTGG + Intergenic
1104277805 12:127345935-127345957 TGTGATTTACTGTCAGGGCTTGG - Intergenic
1106369835 13:29121620-29121642 TGTGAGTGACTAGCAGAGCAGGG - Intronic
1107005877 13:35611070-35611092 TGTGCATCTCTACCAGGGCTTGG - Intronic
1107017051 13:35716017-35716039 TGTGAGACCCCGGCAGGGCTTGG - Intergenic
1107443066 13:40445718-40445740 TGTGAGTCAAGAGCTGGCCTCGG + Intergenic
1107607962 13:42080967-42080989 TGTGACTTACTGGCTGGGCTGGG - Intronic
1108340638 13:49495885-49495907 TTTGAGTCACTAGCCGGCCCGGG - Intronic
1109508269 13:63335813-63335835 TCTAAGTCTCTAGCAAGGCTGGG + Intergenic
1111904876 13:94243518-94243540 TGTCACTCACTGGCAGGACTGGG + Intronic
1112380994 13:98889930-98889952 TGTGAGTCACTAGGATGGTATGG - Intronic
1112753458 13:102605225-102605247 GGTGGGTCACTGGCAGGCCTTGG + Intronic
1115350499 14:32389885-32389907 TGTGGGTCTCTAGCAAGGCCAGG + Intronic
1115370983 14:32614739-32614761 TGTGATTCACTGGCTGGGCTGGG - Intronic
1115527094 14:34292280-34292302 TCTGGGTCTCTAGCAAGGCTGGG + Intronic
1116088853 14:40278252-40278274 TCTAAGTCTCTAGCAAGGCTGGG + Intergenic
1118469104 14:66058050-66058072 TGTGATTCATTAGGAGGCCTGGG - Intergenic
1120428966 14:84389644-84389666 TGTGAGTAACTACCATGGTTTGG + Intergenic
1122543758 14:102511220-102511242 TGTGAGTGCCTACCTGGGCTGGG - Intergenic
1123191582 14:106576766-106576788 TGTGAGTCAGGTGAAGGGCTGGG - Intergenic
1125005429 15:34811404-34811426 TCGGAGTCACTTGGAGGGCTTGG + Intergenic
1126535103 15:49752703-49752725 TATGAGTCACAAGCAGGGACAGG - Intergenic
1126977442 15:54199294-54199316 TGTGGCTCTCTAGCAAGGCTGGG - Intronic
1127280405 15:57486060-57486082 GGTGAGTCAGGAGCAGGGCCCGG + Intronic
1129953901 15:79615758-79615780 TGCGAGTTTCTAGCAAGGCTAGG - Intergenic
1133572982 16:7060295-7060317 TTTCAGTCACCAGCAGGGGTTGG - Intronic
1133829776 16:9310784-9310806 TGGGAGTGACAGGCAGGGCTGGG + Intergenic
1135185827 16:20314991-20315013 TGCCAGTCAGTAGCAGAGCTGGG + Intronic
1137514400 16:49130491-49130513 TGTGACTAAGAAGCAGGGCTGGG + Intergenic
1138334422 16:56241263-56241285 TGTGAATGAGTAGCAGTGCTGGG + Intronic
1138360999 16:56426760-56426782 CGTGAGTCACTGGCTGGGATAGG + Intergenic
1143201993 17:5119761-5119783 TGTGAGTCACTTGTAGTGCTGGG - Intronic
1143325067 17:6093342-6093364 TGTGTGTCAGGATCAGGGCTTGG + Intronic
1143959841 17:10707509-10707531 TGGAAGTCATTACCAGGGCTTGG + Intronic
1144627429 17:16851397-16851419 TGTGAGTCACTTGTAGTGCTGGG + Intergenic
1144879011 17:18421322-18421344 TGTGAGTCACTTGTAGTGCTGGG - Intergenic
1145153225 17:20523072-20523094 TGTGAGTCACTTGTAGTGCTGGG + Intergenic
1146741556 17:35288498-35288520 TGTGTGAAACTAGCAGGTCTAGG - Intergenic
1147402572 17:40189798-40189820 TGGGAGGCACTAGCTGGGCATGG + Intronic
1147581561 17:41630072-41630094 TGTGAGTCACTTGTAGTGCTGGG + Intergenic
1148124741 17:45230890-45230912 TGTGAGTCACTAGCAGGGCTGGG + Intronic
1148864920 17:50623531-50623553 TGTGAGCCACCTGCAGGGCTGGG + Intronic
1149410755 17:56404202-56404224 TCTAGGTCACTAGCAAGGCTGGG + Intronic
1151348847 17:73519671-73519693 TGTGTGTCAGTGGCAGAGCTGGG + Intronic
1152515586 17:80821917-80821939 TGTGTGTGACCAGCTGGGCTTGG + Intronic
1152773823 17:82187639-82187661 CGGGGGTCACTGGCAGGGCTCGG + Intronic
1153411054 18:4793317-4793339 TGTGTGTCTCTTCCAGGGCTTGG - Intergenic
1155873025 18:31050796-31050818 TTTGAGTCATTTGCAGAGCTGGG - Intergenic
1156353509 18:36321862-36321884 TGTGAGTCATGAGGAGGGCGTGG + Intronic
1157587666 18:48815310-48815332 TATGAGCCAGTGGCAGGGCTGGG - Intronic
1157732704 18:50018240-50018262 TATGAGTGACTAGCTGGGCATGG - Intronic
1158560004 18:58505648-58505670 TGTGAGTCAGTAGTTGGGGTGGG - Intronic
1159371769 18:67536734-67536756 TGTGCGTCCCTTGCAGGACTTGG + Intergenic
1159763816 18:72461153-72461175 AGTGAGTCAATGGTAGGGCTGGG + Intergenic
1160566479 18:79789484-79789506 TGTGAGTCAGCAGCACGGGTGGG + Intergenic
1161155956 19:2732043-2732065 TGAGACTCACGAGCAGGGCCAGG - Intronic
1162807158 19:13143997-13144019 TGGGAGTCCCAATCAGGGCTCGG + Intergenic
1165075355 19:33277324-33277346 TGTGCGTGACAAACAGGGCTGGG + Intergenic
1165246622 19:34501596-34501618 TGTGAATCACTCGCGGGGCTGGG + Exonic
1165700542 19:37933778-37933800 GATGAGTCACTACCAGGCCTGGG - Intronic
1165707617 19:37987672-37987694 TGTGAGTGACCAGCTGGCCTAGG - Intronic
1166528017 19:43525628-43525650 TGTGAGGCAACGGCAGGGCTAGG + Intronic
1168473702 19:56661061-56661083 TGTGGGGAACTGGCAGGGCTGGG - Intergenic
926346970 2:11955819-11955841 TTTGAGGCAAGAGCAGGGCTAGG + Intergenic
926896049 2:17690147-17690169 TGTGAGTGACTAGCAGACCATGG + Intronic
927328196 2:21831376-21831398 TCTAAGTCTCTAGCAAGGCTGGG + Intergenic
928820437 2:35355350-35355372 TGTGTGTCACTGCCATGGCTCGG + Intergenic
932476238 2:72008048-72008070 TGTGAGTGACCACCAGGGCATGG - Intergenic
936084800 2:109459975-109459997 TGACAGTCCCTTGCAGGGCTGGG - Intronic
941093633 2:161210335-161210357 TGTTAATGACTAGCAAGGCTTGG - Intronic
942522028 2:176814563-176814585 TGTAAGTAATTAGCAGGGGTTGG + Intergenic
944957200 2:204825518-204825540 TGTCAGTCATTAGCATGACTAGG + Intronic
1169260624 20:4135741-4135763 TCTGAGTCACTGGAAGGACTGGG - Intronic
1170034497 20:11975853-11975875 AGTGAGTCACTGGCTGGGCATGG + Intergenic
1172330370 20:34071755-34071777 TGTTAGTGAATGGCAGGGCTGGG - Intronic
1172902285 20:38344043-38344065 TGGGAGTCATTTGCAGGGGTGGG - Intergenic
1173492200 20:43492089-43492111 TGTCAGTCACTGCCAGGCCTTGG + Intergenic
1173849875 20:46211021-46211043 AGTGAGTCCCTAGCAGAGCCAGG + Intronic
1174129808 20:48335390-48335412 TGGCAGTCACTTCCAGGGCTGGG + Intergenic
1176039602 20:63058331-63058353 TGTGAGTGACTGACAGGGTTTGG - Intergenic
1179915655 21:44476537-44476559 TGAGAGTCACTATCAGGTCATGG + Intergenic
1180043797 21:45293651-45293673 TGTGAGTCAGTGGCAGGGCAGGG + Intergenic
1180890953 22:19288652-19288674 TGTGAGGCAGTAGCAGGTCCTGG - Intronic
1181549988 22:23632393-23632415 TGTGAGTCACTAGCCTGACCTGG - Intergenic
1182310615 22:29402944-29402966 TGTGAGCCACTAGCCTGACTTGG + Intronic
1182690434 22:32157802-32157824 TGTGAGCCACTAGCCTGACTTGG - Intronic
1182690666 22:32159375-32159397 TGTGAGCCACTAGCCTGACTTGG - Intergenic
1183573480 22:38671780-38671802 AGTTAGTCAGTAGCAGAGCTGGG - Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
950621285 3:14207560-14207582 TGGGAGTCACCTGGAGGGCTTGG - Intergenic
951463625 3:22977906-22977928 AGTCAGTGAATAGCAGGGCTAGG - Intergenic
951519376 3:23597140-23597162 TGTGATTCACCTGCAAGGCTTGG - Intergenic
951879012 3:27462392-27462414 TGTGAGTCAGGAGCAGGAGTGGG - Intronic
956145522 3:66187488-66187510 TGTGAGTCACTATCAGAGTGAGG - Intronic
961521218 3:127468360-127468382 GGAGTGTCACAAGCAGGGCTGGG + Intergenic
962280723 3:134049786-134049808 TGTGAGTCACTAGCAGTAGGTGG - Intronic
962936079 3:140082086-140082108 TGTGAGTCAGAAGCAGTCCTTGG - Intronic
964224128 3:154377873-154377895 TGTCAGTGATTATCAGGGCTGGG - Intronic
967633253 3:191771792-191771814 TGTGAGGCACTAGCAAGATTTGG - Intergenic
968510967 4:995775-995797 TGTGGGGAACTAGCAGCGCTTGG - Intronic
968658690 4:1789811-1789833 TCTGAGTCACCGCCAGGGCTGGG + Intergenic
968859272 4:3153370-3153392 AGTGAGTAAGTAGCAGAGCTAGG + Intronic
969442424 4:7225343-7225365 TCTGAGCCAAGAGCAGGGCTGGG - Intronic
975753582 4:77550062-77550084 TGTGAGGCAGCAGCAAGGCTGGG - Intronic
975825601 4:78316592-78316614 GCTGAGCCTCTAGCAGGGCTGGG - Intronic
983544775 4:168951954-168951976 TCTAAGTCTCTAGCAAGGCTGGG + Intronic
985708713 5:1416076-1416098 GGTGAGCCCCTAGCAGGGCCAGG - Exonic
991395127 5:66197313-66197335 TGTGAGTAACAGGCAGGGCATGG - Intergenic
993883745 5:93393648-93393670 TGTAGGTCTCTAGCAAGGCTGGG + Intergenic
993999253 5:94758711-94758733 TGGGAGTCACTTGGAGGGGTTGG - Intronic
996897770 5:128504917-128504939 CATGAGTCAACAGCAGGGCTAGG + Intronic
999235141 5:150086142-150086164 AGTGAGTCGCTGGCAGAGCTGGG + Intronic
999381029 5:151121631-151121653 TGTGAGTGAGTGGCAGGTCTAGG + Intronic
1000779843 5:165466443-165466465 TCTAAGTCTCTAGCAAGGCTGGG - Intergenic
1000957179 5:167557394-167557416 AATGAGTCACTGGCAGAGCTGGG - Intronic
1001299620 5:170524267-170524289 TGGGTGTCACAAGCAGGGCAGGG - Intronic
1002462022 5:179378630-179378652 TCTGTGTCACTGGCTGGGCTGGG + Intergenic
1002633114 5:180594045-180594067 TGTGGGTCCCCAGCAGCGCTTGG + Intergenic
1002796465 6:474925-474947 TGTGAGTGACTGACAGGACTCGG + Intergenic
1002814007 6:661242-661264 TCTGGGTCTCTAGCAGGGCTGGG - Intronic
1003180636 6:3788553-3788575 TGTGAGTCACGCACAGAGCTTGG - Intergenic
1003985758 6:11433259-11433281 TGTGAGTCACTAGCTGTTTTTGG + Intergenic
1006387354 6:33738796-33738818 TGTAAGTCACTGGCAGTGCTGGG + Intronic
1006717929 6:36131895-36131917 GGTTAGTCAGTAGCAGAGCTGGG + Intronic
1006897946 6:37482708-37482730 TGGGAGTTACTTCCAGGGCTCGG - Intronic
1007168953 6:39848767-39848789 TGTGAGCCTCAGGCAGGGCTGGG - Intronic
1007526760 6:42502752-42502774 TGTCAGTCTCTGGCATGGCTTGG - Intergenic
1008344028 6:50404157-50404179 AGTGAGTCAATGGCAGAGCTAGG + Intergenic
1008814868 6:55553280-55553302 TGTATGTAACTAGCAGGGCATGG + Intronic
1010873476 6:81070647-81070669 TGTGAGCCACTGGCAGTGCCCGG + Intergenic
1014730534 6:125026256-125026278 TGTTAGTCACTGGCAGAGCCTGG - Intronic
1015047432 6:128793248-128793270 TGTTAGTGTATAGCAGGGCTAGG - Intergenic
1016895286 6:149045480-149045502 TTTGTGTGACTAGCAGGGTTGGG - Intronic
1019686916 7:2387153-2387175 CGGGAGTCAGTGGCAGGGCTGGG - Intergenic
1022013537 7:26329429-26329451 TGAGAGTGACTACCAGGACTCGG - Intronic
1023681361 7:42690984-42691006 TGTGAGTGACCAGAAGGACTGGG + Intergenic
1024304628 7:47917433-47917455 TCTGGGTCTCTAGCAAGGCTGGG - Intronic
1025052153 7:55740946-55740968 TGAGAGCCACGAGCTGGGCTGGG + Intergenic
1026349448 7:69503018-69503040 TGGGAGGCAATTGCAGGGCTAGG + Intergenic
1027699366 7:81450501-81450523 TCTAAGTCTCTAGCAAGGCTGGG - Intergenic
1029166103 7:98592211-98592233 TGTGAGTCCCCAGAAGGGCAGGG - Intergenic
1032731759 7:134650101-134650123 TGTCAGTCAGTAGCAGAGCTGGG + Intronic
1034399912 7:150855428-150855450 TGTGAGCCTCCTGCAGGGCTGGG - Intronic
1034561676 7:151884097-151884119 TGTGCCTCTCTAGCACGGCTTGG - Intergenic
1036757236 8:11479063-11479085 TGTCAGTCACTATCAGGAGTTGG - Intergenic
1036945279 8:13089335-13089357 TATCAGTCACTGGCAGGGCATGG + Intronic
1040432345 8:47355910-47355932 TGTTAGTCAAGAGCTGGGCTTGG + Intronic
1044348471 8:91134551-91134573 TGTGAGTCAGTAGAAGGGGTGGG - Intronic
1045174499 8:99707218-99707240 GGTCAGTAAGTAGCAGGGCTGGG - Intronic
1045474936 8:102544684-102544706 TGTGAATCACTTGCAGGGGCAGG + Intergenic
1048869773 8:138787709-138787731 TGTGACTCAAAATCAGGGCTTGG + Intronic
1049117073 8:140698129-140698151 TGTGTGTCACTAGGGGGACTTGG - Intronic
1049428754 8:142549614-142549636 TGTGGGGCTCTAGCAGGGCTGGG - Intergenic
1049563931 8:143327653-143327675 TTCCAGTCACTAGCAGAGCTAGG - Intronic
1051641598 9:19229894-19229916 TGTGAGTCCCTGGCCGCGCTCGG - Intergenic
1051710010 9:19921805-19921827 TGTGAATTGCCAGCAGGGCTTGG - Intergenic
1056839671 9:89988299-89988321 TGTGAGCCACTGGGAAGGCTTGG - Intergenic
1056937859 9:90931324-90931346 TGAGTGTCAAGAGCAGGGCTTGG - Intergenic
1058135289 9:101300546-101300568 TGTAAATCACCAACAGGGCTGGG + Intronic
1059868699 9:118546343-118546365 TGTGGGGCACTAGCAGGCATAGG - Intergenic
1060861307 9:126956991-126957013 TGTGAGTTAGTGGCAGGACTGGG - Intronic
1060902427 9:127271753-127271775 TGAGAGTCAGCAGCTGGGCTGGG - Intronic
1061191529 9:129085350-129085372 AGTGAGTCCCTAGCAGAACTCGG - Intronic
1062207507 9:135345313-135345335 TGTGTGTCACTTGCTGGGTTAGG + Exonic
1062450683 9:136614502-136614524 TGTGAGTCACCAGCCAGGCCAGG + Intergenic
1062705454 9:137937539-137937561 TCTAAGTCTCTAGCAAGGCTAGG - Intronic
1185554105 X:1006896-1006918 TCTTAGTCACTTTCAGGGCTGGG + Intergenic
1185706838 X:2273889-2273911 GGCGAGTCCCTAGCACGGCTCGG - Intronic
1186468653 X:9804247-9804269 TCTGAGTCTCAAGCAGGGCAAGG + Intronic
1190234401 X:48604726-48604748 TGTGAGGTCCTAGCATGGCTTGG - Intronic
1190370991 X:49740468-49740490 TGTGACTCATTAGCTGGGCATGG - Intergenic
1190834673 X:54089669-54089691 TGTGAAACACTAGCCGGGCATGG + Intronic
1192152207 X:68719372-68719394 TGTGCCCCACAAGCAGGGCTGGG + Exonic
1192878222 X:75254630-75254652 TCTAAGTCTCTAGCAAGGCTGGG - Intergenic
1193819199 X:86141938-86141960 TGTGAGTCAGTAACAGTGGTTGG + Intergenic
1195327760 X:103771787-103771809 TGTGAGCCACGAGAATGGCTAGG - Intergenic
1196225030 X:113156765-113156787 TGTAGGTCTCTAGCAAGGCTGGG + Intergenic
1197486395 X:127056546-127056568 TGTGAGGCAGCAGCAAGGCTGGG - Intergenic
1199499840 X:148497554-148497576 GGTGAGGCACTGGCAGGGGTGGG + Intergenic
1199697211 X:150351350-150351372 TGGGAGTCACAGACAGGGCTGGG + Intergenic
1200414995 Y:2900273-2900295 TGTAGGTCTCTAGCAAGGCTGGG - Intronic