ID: 1148127878

View in Genome Browser
Species Human (GRCh38)
Location 17:45246137-45246159
Sequence GGGACCAGGCAGATATTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148127869_1148127878 28 Left 1148127869 17:45246086-45246108 CCTGGGATGGGAAAGGGTTCTTT 0: 1
1: 0
2: 2
3: 19
4: 208
Right 1148127878 17:45246137-45246159 GGGACCAGGCAGATATTCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 181
1148127874_1148127878 -4 Left 1148127874 17:45246118-45246140 CCAGCTGTCCTTGCTGTGGGGGA 0: 1
1: 0
2: 3
3: 28
4: 248
Right 1148127878 17:45246137-45246159 GGGACCAGGCAGATATTCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148127878 Original CRISPR GGGACCAGGCAGATATTCCA GGG Intronic
902677345 1:18018042-18018064 GGGACAAGGCAGAGAGTCCCAGG - Intergenic
903405239 1:23090286-23090308 GCCCCCAGGCAGATATTCAAGGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906274246 1:44504466-44504488 GGGACCTGGCAGAAGTTCGAGGG + Intronic
907696533 1:56735736-56735758 GGGAAGAGGCACATATTACATGG - Intronic
908187566 1:61667293-61667315 GGGCCCACCCAGATAATCCAGGG - Intergenic
909136745 1:71810769-71810791 GGAAGCAGGCACATTTTCCATGG - Intronic
909608926 1:77532928-77532950 GGAACCAGACAGCTACTCCAAGG + Intronic
912234792 1:107837970-107837992 GGGACCTGGCAAATAATTCATGG + Intronic
914980816 1:152412959-152412981 GGAGCCAAGCAGAAATTCCAGGG + Intronic
917681289 1:177370517-177370539 AGGAACAGGCAAATATTTCATGG + Intergenic
919910533 1:202107935-202107957 GGACCCAGACAGTTATTCCAGGG - Intergenic
921253350 1:213317829-213317851 GGGTCCAGGAACATATCCCATGG + Intergenic
921412436 1:214850133-214850155 GGGCCCAACCAGATAATCCAGGG - Intergenic
921869735 1:220126766-220126788 CTGACCTGGCACATATTCCAAGG - Exonic
921913587 1:220579574-220579596 AGGTCCAGGCAGATATTAAAAGG - Intronic
1063586572 10:7358150-7358172 AGGGCCATGCAGATGTTCCAGGG - Intronic
1063586602 10:7358302-7358324 AGGGCCATGCAGATGTTCCATGG - Intronic
1064143131 10:12806814-12806836 GGGACCAGACACAAATTCCCTGG - Intronic
1069295096 10:66834066-66834088 GGAACCAGGGAGACATACCAAGG - Intronic
1071343178 10:84666806-84666828 AGGACCTGGCGGATATTCCCAGG + Intergenic
1072795607 10:98352221-98352243 AGAACCAGGGAGAGATTCCAGGG + Intergenic
1076380378 10:130021197-130021219 GGGACCAGGCAGGCAAACCAGGG - Intergenic
1079852785 11:25558304-25558326 GGAAACAGGCACATATTACATGG + Intergenic
1079950333 11:26793977-26793999 GAGACCAGGAAGATATTTTAAGG + Intergenic
1080441384 11:32298094-32298116 TGGACCAGGGAGCTTTTCCAGGG - Intergenic
1082170363 11:48997148-48997170 GCCCCAAGGCAGATATTCCATGG - Intergenic
1082616960 11:55372437-55372459 GGGAGCAGGCACATCTTACATGG + Intergenic
1082619457 11:55402013-55402035 GGGAGCAGGCACATCTTACATGG + Intergenic
1087503377 11:98988938-98988960 TGGTCCAGGCAGATATTTTATGG - Intergenic
1088355727 11:108942052-108942074 GTGGCCAGGCAGATCTTGCAGGG - Intergenic
1088665291 11:112087669-112087691 GGGAACATGCAGATGTTCCCTGG + Intronic
1091040356 11:132273390-132273412 AAGACCAGGCAGATATCACAAGG - Intronic
1091133663 11:133168227-133168249 GACACCAGGGAGATACTCCAGGG + Intronic
1091674834 12:2481565-2481587 GGTACCAGGAAGACCTTCCAGGG - Intronic
1092578162 12:9812595-9812617 GGGACTAGTCAGGTATCCCAGGG - Intergenic
1092740338 12:11622529-11622551 GGTACCAGGCCAATATTTCAAGG - Intergenic
1100890373 12:99119132-99119154 GGGCCCATCCAGATAATCCATGG - Intronic
1101527091 12:105540950-105540972 GGAAGCAGGCACATATTACATGG - Intergenic
1102963275 12:117107490-117107512 GGGCCCACCCAGATAATCCAGGG - Intergenic
1103676422 12:122659547-122659569 GAGGCCAGGCACAGATTCCAGGG + Intergenic
1104204850 12:126628886-126628908 TGGACCAACCAGATAATCCAGGG + Intergenic
1104690643 12:130823461-130823483 GGGCCCACCCAGATAATCCAGGG - Intronic
1104716519 12:131019814-131019836 TGCTCCAGGGAGATATTCCAGGG + Intronic
1112933452 13:104770000-104770022 AGGAGCAGGGAGATATTCAATGG + Intergenic
1113455668 13:110446821-110446843 GGGAGTAGGCAGGTAGTCCAGGG - Exonic
1113887574 13:113668935-113668957 GAGAACACGCAGATGTTCCAGGG - Intronic
1125188015 15:36955036-36955058 GGGTACAGGCAGACATGCCAAGG + Intronic
1126974753 15:54163143-54163165 GGGTCCACTCAGATAATCCAGGG - Intronic
1128612516 15:69085275-69085297 GGGCCCACCCAGATAATCCAGGG - Intergenic
1128798922 15:70484698-70484720 GGGAGCAGGCAGAGACTACAGGG + Intergenic
1129712998 15:77830654-77830676 CGGAATAGGCAGATATTCCTTGG - Intergenic
1132091755 15:98953086-98953108 GGGACCCGGCAGAGGTTTCAAGG - Intronic
1133496637 16:6324494-6324516 GGGAGCAGGCACATCTTACATGG + Intronic
1134587008 16:15420326-15420348 GTGGCCATGGAGATATTCCAGGG + Intronic
1136551167 16:30983346-30983368 GTGACCAGGCAGATGCTCGAAGG + Intronic
1138097446 16:54223204-54223226 GGGCCCAGGCAGAAGTTGCAAGG - Intergenic
1139521704 16:67486562-67486584 GGAACCAGCCTGATATTCCCAGG + Intergenic
1140453544 16:75090732-75090754 GGGACCAGGCAGAAAATTCAGGG - Intronic
1141414538 16:83860064-83860086 GGGACGAGGAAAATGTTCCAGGG + Intergenic
1143984312 17:10898194-10898216 GGGAGCAGGCACATCTTACACGG + Intergenic
1145732930 17:27206241-27206263 GGGCCCACGCAGATAATCCACGG + Intergenic
1148127878 17:45246137-45246159 GGGACCAGGCAGATATTCCAGGG + Intronic
1148199089 17:45736526-45736548 GGGAGCAGGCACATATTACACGG + Intergenic
1150228846 17:63538904-63538926 GTGGCCAGGCAGGGATTCCAGGG + Intronic
1152403428 17:80083054-80083076 GGGTCCAGGCAGTTAATCCAGGG + Intronic
1152475881 17:80517938-80517960 GGGACCAGGCATAGCTCCCAGGG + Intergenic
1152550794 17:81028884-81028906 GGGGCCAGGACGAGATTCCAGGG + Intergenic
1153104793 18:1514025-1514047 GGAAGCAGGCACATCTTCCATGG + Intergenic
1157977099 18:52340088-52340110 TGGATCAGGCAAAGATTCCACGG - Intergenic
1158231881 18:55265806-55265828 TGAACCAGATAGATATTCCAGGG + Intronic
1160418262 18:78726912-78726934 GGGAGCAGGCAGGTATTCCTTGG - Intergenic
1161162831 19:2770135-2770157 GGGACCAGGCGGATGTCCGAGGG - Intronic
1163644610 19:18481537-18481559 GGGACCACCCAGATAATGCAGGG + Intronic
1165192109 19:34073484-34073506 GGGAGCAGGCATGTCTTCCAAGG - Intergenic
1167761246 19:51451082-51451104 GGAACCAGGCACATCTTACATGG + Exonic
925353963 2:3224160-3224182 GGGACCAGGCAGAGACTACAGGG - Intronic
925412813 2:3649752-3649774 GGGACCGGGCAGACACACCAGGG + Intergenic
925821314 2:7802239-7802261 GGGACAAGGCACATCTTACATGG - Intergenic
926647655 2:15307003-15307025 GGGACCAGGCAGAAATCCTGGGG + Intronic
927194516 2:20538530-20538552 GGGGCCTGGGAGATATTTCAGGG - Intergenic
931154855 2:59616268-59616290 GGAAGCAGGCACATATTACATGG + Intergenic
931940403 2:67245850-67245872 GGGCCCACCCAGATAATCCAGGG - Intergenic
932879380 2:75486716-75486738 GGGAAGAGGCAGATCTTACACGG - Intronic
933700992 2:85255496-85255518 GAGACCAGGCAGCTTTCCCAGGG + Intronic
933989137 2:87621153-87621175 GGGATGAGGCAGAAATTCCAGGG - Intergenic
934566253 2:95343183-95343205 GGGGACAGGCAGATATTCCAAGG + Intronic
935171631 2:100614847-100614869 GGGACCAGGCTGGGATTGCATGG - Intergenic
936304706 2:111329673-111329695 GGGATGAGGCAGAAATTCCAGGG + Intergenic
937447028 2:121967100-121967122 GGGAGCAGGCACATCTTACATGG + Intergenic
940944370 2:159599232-159599254 GGGACCAGGCTAGTTTTCCAGGG - Intronic
941047861 2:160696530-160696552 GGCATAAGGCAGATATTCAATGG + Intergenic
941314747 2:163978593-163978615 GGGACCATGTAGACATACCAGGG - Intergenic
946160479 2:217832740-217832762 GGGAACAGGAAGATATCACAGGG + Intronic
946922207 2:224591695-224591717 GGCACCAGTCAGAAATCCCACGG - Intergenic
948747955 2:240109542-240109564 GGGACCAGGCACCTACTGCAGGG + Intergenic
948783334 2:240338335-240338357 GGGTCCAGGCAGAGGTGCCATGG + Intergenic
1170182164 20:13543995-13544017 GGGACCAGCCAAATATTTCACGG - Intronic
1172941215 20:38656020-38656042 GGGACCAGGTAGAAATGCCGGGG - Intergenic
1173281965 20:41636688-41636710 GGGCCCACACAGATAATCCAGGG - Intergenic
1173723005 20:45276561-45276583 GTGGCCAGGTAGATACTCCATGG + Intergenic
1173951449 20:46996825-46996847 GGAAGCAGGCACATTTTCCATGG + Intronic
1176247088 20:64102472-64102494 GGGACCAGGCAGATCCGGCACGG - Intergenic
1177172400 21:17668888-17668910 GAGAGCAGTCAGATATCCCAGGG + Intergenic
1177186894 21:17807310-17807332 GGGAGCAGGCACATCTTACATGG - Intronic
1178702951 21:34848885-34848907 GGTACCAGGAAAATATTCAAAGG + Intronic
1179267805 21:39820494-39820516 GGGACCATGGACATATTCCTGGG + Intergenic
1184614619 22:45629683-45629705 GGGGCCATGCAGATATTCTGGGG + Intergenic
1184920714 22:47603680-47603702 GGAAGCAGGCAGGTCTTCCATGG - Intergenic
949671976 3:6409214-6409236 AGGACCAGTCAGCTATTCAAAGG - Intergenic
950420770 3:12898099-12898121 GGGACCAGGCAGACATCCTGGGG + Exonic
954295108 3:49670135-49670157 GGGATGAGGCAGGTATTCCATGG - Exonic
957885544 3:86282559-86282581 GGGACCAGGCACATGTAGCAGGG - Intergenic
959284687 3:104392190-104392212 GGAAACAGGCATATATTACATGG + Intergenic
959801824 3:110504354-110504376 GGGAGCAGGCACATATGCCCAGG - Intergenic
963308635 3:143682886-143682908 GGGCCCATTCAGATAATCCAGGG + Intronic
964225181 3:154390094-154390116 CAGACCAGCCAGAGATTCCAGGG - Intronic
966439486 3:179928095-179928117 AGGAACAGGCAGATAGTCCCTGG - Intronic
972773345 4:42218888-42218910 GGGACAAAGCAGAGATTACACGG + Intergenic
972829752 4:42801791-42801813 GGAAGCAGGCACATATTACATGG + Intergenic
972897650 4:43643713-43643735 GGAAGCAGGCACATATTACATGG + Intergenic
976086376 4:81410935-81410957 GGGAGCAGGCATATCTTACATGG - Intergenic
978699116 4:111621765-111621787 GGAAGCAGGCACATCTTCCACGG + Intergenic
979537455 4:121839643-121839665 GGTGCCAGGCAGATACTACAAGG - Exonic
982506169 4:156219844-156219866 GGGAGCAGGCATATCTTACATGG - Intergenic
984141631 4:176011388-176011410 GAGATCAGGCTGATTTTCCAGGG + Intergenic
984281471 4:177675554-177675576 TGGAAAAGGCAGATATTTCAAGG - Intergenic
984397450 4:179219859-179219881 GGAACCAGGCACATTTTACACGG + Intergenic
985395543 4:189539318-189539340 GGGACCAGGGAGAAAAGCCAGGG + Intergenic
985813412 5:2108244-2108266 GGAAGCAGGCACATATTACATGG + Intergenic
986279556 5:6312285-6312307 GGGACAAGGCAGATATGAGAAGG + Intergenic
986661553 5:10064634-10064656 GGGACCAGCCACAGATGCCATGG - Intergenic
990311753 5:54546976-54546998 GGGACCTGGCATATCTTGCAAGG + Intergenic
990865352 5:60373941-60373963 GGGCCCACCCAGATAATCCAGGG + Intronic
991525232 5:67549007-67549029 AGGCACAGGCAGATTTTCCATGG - Intergenic
991971665 5:72147553-72147575 GGGACCAAGCATCTATGCCAGGG - Intronic
992551171 5:77861752-77861774 CTGACCAGGCAGGTTTTCCAGGG - Intronic
994578418 5:101610119-101610141 GGGACTCTGTAGATATTCCAGGG - Intergenic
994925516 5:106113292-106113314 GGAAGCAGGCATATCTTCCATGG - Intergenic
997627910 5:135343518-135343540 GGGCCCAGGAAGATATACCGTGG - Exonic
998921297 5:147071171-147071193 GGGACCAAGCTGACATTCCAAGG + Intronic
1001088689 5:168720923-168720945 GGGACCCGGGAGCCATTCCAGGG - Intronic
1001233987 5:170014098-170014120 GGGAAAGGGCAGATATTACAAGG + Intronic
1003147594 6:3521776-3521798 GGAAGCAGGCACATCTTCCATGG + Intergenic
1003559899 6:7171807-7171829 GGGTGCAGGCAGATATTCTGGGG + Intronic
1005375577 6:25179138-25179160 GGGCCCACCCAGATACTCCAGGG + Intergenic
1006640165 6:35485679-35485701 GGGGGCAGGCAGATGGTCCAGGG - Intronic
1007115342 6:39339391-39339413 GGGAAAAGGCGGAAATTCCAAGG - Intronic
1007245560 6:40459627-40459649 GGGAACATGCAGATTTTTCAAGG - Intronic
1007717462 6:43865484-43865506 GGGGTCAGGGAGAAATTCCAGGG - Intergenic
1008346793 6:50437543-50437565 GGGAGCAGGCACATCTTACATGG + Intergenic
1010300018 6:74249040-74249062 GGGAATATGCAAATATTCCATGG - Intergenic
1012377435 6:98579422-98579444 TGGACCAGGCAGACATGGCAAGG - Intergenic
1013167200 6:107604976-107604998 GAGGCCAGGGAGAAATTCCAGGG - Intronic
1013848018 6:114478252-114478274 GGGAGCAGGCACATCTTACATGG + Intergenic
1015075492 6:129151653-129151675 GGGAGCAGGCACATCTTACATGG + Intronic
1015379543 6:132551096-132551118 TGAAACAGGCAGTTATTCCATGG + Intergenic
1016281964 6:142428612-142428634 GGGAGCAGGCACATCTTACATGG + Intronic
1016867092 6:148778430-148778452 GGGCCCAGGCAGACATACTAGGG + Intronic
1018685476 6:166300847-166300869 TGGGCCAGGCAGATAATCTAAGG - Intergenic
1018745044 6:166755195-166755217 GGGTAAAGGCAGATCTTCCAAGG + Intronic
1021867694 7:24975259-24975281 TGGACCAAGGAGATATTGCAAGG - Intronic
1022258135 7:28679623-28679645 CTGACCAGGAAGATTTTCCAAGG - Intronic
1023275989 7:38518853-38518875 GGGACCAGGAAGGAATTCTATGG + Intronic
1023865984 7:44238668-44238690 GGGACCCGGCAGAGGTTCCAGGG - Intronic
1025280492 7:57623568-57623590 GGGACAAGGCAGCACTTCCAGGG - Intergenic
1025304239 7:57841939-57841961 GGGACAAGGCAGCACTTCCAGGG + Intergenic
1029309485 7:99649148-99649170 GGGACAGGGAAGATATTCCCTGG - Intronic
1030249879 7:107430795-107430817 GGAACAATGCAGATATGCCATGG + Intronic
1030285735 7:107824952-107824974 GGGCCCACCCAGATAATCCAAGG - Intergenic
1031279669 7:119782335-119782357 GGAAGCAGGCACATATTACATGG + Intergenic
1031749898 7:125558319-125558341 GGAAGCAGGCACATCTTCCATGG + Intergenic
1032307045 7:130744554-130744576 GAGTCCAGCCAGACATTCCAAGG - Intergenic
1032849580 7:135782619-135782641 GAGACCAGGCAGACCTGCCAGGG - Intergenic
1033262842 7:139858537-139858559 TGGACCAGACAGACATTCAATGG - Intronic
1035822637 8:2610753-2610775 GGGAGCAGGCACATCTTCCAGGG - Intergenic
1047596281 8:126380861-126380883 GGGTCCTGGCAGACTTTCCATGG + Intergenic
1048759616 8:137779194-137779216 AGGACCAGGCTAATCTTCCAGGG + Intergenic
1048801689 8:138199708-138199730 GGAAGCAGGCACATATTACATGG + Intronic
1049156346 8:141069160-141069182 GGGCCCATCCAGATACTCCAGGG + Intergenic
1051744371 9:20280763-20280785 GGGCCCAAGCAGATAATCCAGGG - Intergenic
1053165575 9:35841583-35841605 GGGGGCAGGCAGATACCCCACGG - Exonic
1057899659 9:98938512-98938534 GGGACCAGCAGGATAGTCCATGG - Intergenic
1058653315 9:107197214-107197236 GGGAGCAGGCACATCTTACATGG + Intergenic
1059531458 9:115039224-115039246 GGCACCAGGCAGAGAAGCCATGG - Intronic
1185886511 X:3788373-3788395 GGAAGCAGGAAGATACTCCAAGG - Intergenic
1187024379 X:15418788-15418810 GGGAAAATGCATATATTCCAAGG - Intronic
1187744050 X:22388949-22388971 TGGCCCAAGCAGATAATCCAGGG + Intergenic
1189069801 X:37851264-37851286 GGAAGCAGGCACATATTACATGG - Intronic
1190377406 X:49803104-49803126 GGGACCCTGCAGACATTCAAAGG + Intergenic
1190858856 X:54324224-54324246 GGGTCCACCCAGATAATCCAGGG + Intronic
1192388496 X:70699028-70699050 GAGACCAGGCAGATACTGCAAGG - Intronic
1193489581 X:82133125-82133147 GGAACCAGGCACATCTTACATGG + Intergenic
1195453683 X:105043783-105043805 TGGACCAGGCAAATATTCATTGG - Intronic
1197419880 X:126225743-126225765 GGGAGCAGGCACATCTTACATGG - Intergenic
1199519627 X:148720996-148721018 GAGACAAGGAAAATATTCCAGGG - Intronic
1200775760 Y:7168720-7168742 GGCAACAGGCAGAAACTCCAAGG + Intergenic
1201529664 Y:14977991-14978013 GGGGCCTGCCAGAGATTCCAAGG + Intergenic