ID: 1148128078

View in Genome Browser
Species Human (GRCh38)
Location 17:45247066-45247088
Sequence GAGGCGGGCCACAGCGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148128078_1148128088 13 Left 1148128078 17:45247066-45247088 CCTCCTCCGCTGTGGCCCGCCTC 0: 1
1: 0
2: 0
3: 21
4: 291
Right 1148128088 17:45247102-45247124 CATCCTCCTCTTGGCCACAGAGG 0: 1
1: 0
2: 6
3: 18
4: 269
1148128078_1148128087 4 Left 1148128078 17:45247066-45247088 CCTCCTCCGCTGTGGCCCGCCTC 0: 1
1: 0
2: 0
3: 21
4: 291
Right 1148128087 17:45247093-45247115 GGGCTGGTGCATCCTCCTCTTGG 0: 1
1: 0
2: 1
3: 27
4: 237
1148128078_1148128089 14 Left 1148128078 17:45247066-45247088 CCTCCTCCGCTGTGGCCCGCCTC 0: 1
1: 0
2: 0
3: 21
4: 291
Right 1148128089 17:45247103-45247125 ATCCTCCTCTTGGCCACAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148128078 Original CRISPR GAGGCGGGCCACAGCGGAGG AGG (reversed) Exonic
900018698 1:171917-171939 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900048956 1:530512-530534 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900071187 1:772336-772358 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
901096122 1:6681734-6681756 GAGGCAGGCCACAGTGAATGTGG - Intronic
901138825 1:7014722-7014744 GAGGTGGGACTCAGCCGAGGGGG + Intronic
902876314 1:19342926-19342948 GCAGGGGGCCACAGCTGAGGAGG + Intronic
903218339 1:21855191-21855213 GAAGGGAGCCACAGAGGAGGAGG + Intronic
903263484 1:22143250-22143272 GGGGCGGGCCGGAGCGGCGGCGG + Intronic
903785673 1:25859520-25859542 TGGGCGGGGCACAGCGAAGGGGG - Intergenic
904369643 1:30040307-30040329 GAGGAGGCCCACAGGTGAGGTGG + Intergenic
904607267 1:31704592-31704614 GAGTCAGGCCAGAGCAGAGGGGG - Intergenic
905308526 1:37034561-37034583 GAGGCAGGGCGCAGGGGAGGGGG - Intergenic
907278111 1:53328029-53328051 GGGGCGGGCGGCAGCGGCGGCGG - Intronic
913523003 1:119663958-119663980 GAGGTGGGACACAGTGGAGAAGG + Intronic
914899658 1:151705002-151705024 GAGGGAGGCCACAACGGAGCGGG + Intronic
917584957 1:176416891-176416913 GAGTCTGGCCACAGCGGCGTTGG + Intergenic
921010277 1:211134119-211134141 GAGGCGGGCCGCAGGGAGGGAGG - Intergenic
922106548 1:222517785-222517807 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
924348732 1:243095351-243095373 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1062993964 10:1847549-1847571 GAGGTGGGCCCCAGCGGTGAAGG + Intergenic
1063387689 10:5626387-5626409 GAGCCGGGCCGCAGCAGTGGAGG - Intergenic
1063463692 10:6229946-6229968 GAGGCGGGCCACACAGCAGGAGG - Intronic
1064698260 10:17989510-17989532 GAGGGAGCCCACAGCGAAGGTGG + Intronic
1065603051 10:27389213-27389235 GAGCTGGGCCTCAGCTGAGGGGG + Intergenic
1065697294 10:28391392-28391414 GAACTGGGCCACAGAGGAGGAGG + Intergenic
1066727628 10:38409552-38409574 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1066986896 10:42475966-42475988 CAGGAGGGCCCCAGCGGTGGGGG + Intergenic
1067474698 10:46557546-46557568 AAGGCGGGCTCCAGTGGAGGTGG - Intergenic
1067553821 10:47253965-47253987 GGGGCCGGCTACAGCGGGGGTGG + Intergenic
1067669628 10:48306989-48307011 GAGGCGGGGGCCAGCCGAGGGGG + Intronic
1071493520 10:86152589-86152611 GGGGCCTGCCACAGGGGAGGTGG + Intronic
1074962903 10:118463965-118463987 GTGGCTGTCCACAGCTGAGGAGG + Intergenic
1075845721 10:125543884-125543906 GTGGCGGCCTACAGAGGAGGAGG + Intergenic
1076256905 10:129034065-129034087 TAGGCTGGCCACAGCGGTGGAGG - Intergenic
1076314245 10:129529510-129529532 GAAACGGGCCACAGAGGAGGAGG - Intronic
1076527529 10:131121711-131121733 GAGGCAGGCCAGGGCCGAGGGGG - Intronic
1076527558 10:131121860-131121882 GAGGCAGGCCAGGGCTGAGGGGG - Intronic
1076683525 10:132186892-132186914 GGGGCGGGGCCCAGCGGGGGCGG + Exonic
1076975300 11:167113-167135 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1077306215 11:1869775-1869797 GGGGCGCCCCACAGAGGAGGGGG + Intronic
1077435528 11:2537031-2537053 GAGGGGGGTCACAGTGGAGTAGG - Intronic
1077875769 11:6303726-6303748 TAGGCAGGACAAAGCGGAGGGGG - Intergenic
1078870744 11:15342317-15342339 GAGGCTGGCCAAAGGGAAGGCGG - Intergenic
1079112094 11:17610688-17610710 GAGGCAGGCCAGAGAGGAGCTGG - Exonic
1081672625 11:44950360-44950382 GAGGAGGGCGACCGCGGAGCCGG + Intronic
1083609944 11:63999896-63999918 GAGGGGGCCCACAGGGGTGGGGG - Intronic
1084008683 11:66336086-66336108 CAGGCGGGCCGCAGCGGCCGGGG - Exonic
1084517559 11:69644837-69644859 AAGGTGGGCCACAGCAGAGCTGG - Intronic
1084627874 11:70322829-70322851 GAGGCTGAACACAGCGGGGGTGG - Intronic
1085076595 11:73597698-73597720 GGGGCGGGCGACAAGGGAGGAGG - Intronic
1085218199 11:74850445-74850467 GAGGCGGGCTGCAGAGGGGGTGG + Intronic
1085332810 11:75667702-75667724 GAGGCGGCCCCCGGCGGAGCGGG - Exonic
1085761236 11:79243188-79243210 GAGGCAGGGAACAGGGGAGGAGG + Intronic
1090636827 11:128694688-128694710 GAGGCGGAACACGGCGGGGGCGG + Intronic
1091796081 12:3298086-3298108 GGGGCTGGACACAGAGGAGGGGG + Intergenic
1092651659 12:10641493-10641515 GAGGAGGGCCCAAGCTGAGGAGG + Intronic
1096435778 12:51590689-51590711 GACGCGGGCCACAGAGCACGCGG + Intronic
1096647822 12:53047905-53047927 GAGCCCGGCCGCCGCGGAGGAGG - Intronic
1097264697 12:57738396-57738418 GAGGGGGGCGCAAGCGGAGGCGG - Intronic
1097822918 12:64145772-64145794 GAGGCAGCACACAGGGGAGGTGG + Exonic
1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG + Intergenic
1099713719 12:86264453-86264475 GACGCGGGCTGCAGCGGGGGAGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101881570 12:108629370-108629392 GAGCCAGGCCACAGCTGAGCAGG + Intronic
1105378075 13:19863227-19863249 GAGGCGGTCGCCAGCGGCGGAGG - Intronic
1105389184 13:19959138-19959160 GAGGCGGCCGCCAGCGGCGGGGG + Intronic
1105545405 13:21347402-21347424 GGTGCGTGCCACAGAGGAGGTGG + Intergenic
1106138051 13:26989435-26989457 GAGGCGGTGCAGAGAGGAGGCGG + Intergenic
1106269487 13:28139105-28139127 GGGGCGGGCCGCGGCGGCGGAGG + Intronic
1106480431 13:30133363-30133385 GAGGCAGGCCACAGCGCTGTGGG + Intergenic
1108396589 13:49996807-49996829 GAGGCGGGACACAGGCGAAGCGG + Intronic
1111201256 13:84940338-84940360 GAACCGGGCCACAGGGCAGGAGG + Intergenic
1111919561 13:94396129-94396151 GGGGCTGGCCACAGGAGAGGGGG - Intronic
1112638523 13:101245128-101245150 GAGGAGGGCCAAAGCAGTGGAGG - Intronic
1113813134 13:113154148-113154170 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813142 13:113154164-113154186 GAGGCGGGGCGCGGGGGAGGAGG + Intergenic
1113813210 13:113154304-113154326 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813218 13:113154320-113154342 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813226 13:113154336-113154358 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813234 13:113154352-113154374 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813242 13:113154368-113154390 GAGGCGGGGCGCGGGGGAGGCGG + Intergenic
1113813250 13:113154384-113154406 GAGGCGGGGCGCGGGGGAGGAGG + Intergenic
1113908443 13:113830837-113830859 GAGGAGGGCCCCAGGGCAGGTGG - Intronic
1114508646 14:23237916-23237938 GAGGCTGGGCGCAGCCGAGGCGG - Intronic
1114614055 14:24059105-24059127 GAGGCGGGGCTCAGAGTAGGAGG - Intronic
1117029069 14:51651345-51651367 AAGGCGGTCCCCGGCGGAGGTGG - Intronic
1118777292 14:68980613-68980635 GAGGCTGGCCACGGTGGCGGTGG + Intergenic
1119418699 14:74493512-74493534 GAGGCGGGGCGGGGCGGAGGTGG - Exonic
1119771479 14:77222703-77222725 GAGAAGGGCCACTGCGGAAGGGG - Intronic
1121180480 14:91925290-91925312 GAGCCGGGCCAGAGGGGAGATGG - Intronic
1121777116 14:96598260-96598282 GAGGAGGGGCAGAGCAGAGGAGG - Intergenic
1122112059 14:99510026-99510048 GCGTTGGGCCACAGAGGAGGCGG + Exonic
1122145947 14:99688893-99688915 GATGCGGGACAAGGCGGAGGGGG - Intronic
1122309090 14:100783379-100783401 GACCCAGGCCACAGCAGAGGAGG + Intergenic
1124922392 15:34039190-34039212 GAGGCCGGCCGCAGCGGAGCGGG + Intronic
1128976262 15:72155979-72156001 GAGGAGGACCAAAGCGGAAGCGG + Intergenic
1129676043 15:77632822-77632844 GCGGCGGGCGACAGCGCAGGCGG - Intronic
1130019462 15:80215751-80215773 GGGGCGGGCCACTGCTGAGTTGG - Intergenic
1130954941 15:88621197-88621219 GAGGCGGGCGAGAGCAGAAGGGG - Intergenic
1131249255 15:90819902-90819924 GGTGGGGGCCACAGCGCAGGGGG - Intergenic
1132663934 16:1073188-1073210 GACGGGGGCCACAGCGGGGCTGG + Intergenic
1133183967 16:4081810-4081832 GAGGGGGGCAGCAGGGGAGGAGG + Intronic
1133784564 16:8964034-8964056 CAGGCGGGCCTCGGCGGCGGCGG - Intronic
1134065457 16:11225462-11225484 GAGGCGGCCCCTAGCTGAGGAGG - Intergenic
1135852736 16:25979330-25979352 GAGCCGGGCCACACCACAGGAGG + Intronic
1136295848 16:29301647-29301669 GAGGCGGGGCACAGGGGAACAGG + Intergenic
1136500976 16:30669571-30669593 GGGGCGGGCACAAGCGGAGGTGG - Exonic
1138475921 16:57270564-57270586 GAGAAGGGCCAGAGCGGGGGTGG - Intronic
1139650686 16:68360654-68360676 GAGCCGGCCCACACTGGAGGCGG + Exonic
1141736898 16:85859966-85859988 GAGGGTGGCCACATCGGAGGTGG + Intergenic
1142101767 16:88275834-88275856 GAGGCGGGGCACAGGGGAACAGG + Intergenic
1142283319 16:89160608-89160630 GAGGGAGGCCATGGCGGAGGCGG + Intergenic
1142444960 16:90130546-90130568 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1142462550 17:104920-104942 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1142756184 17:2017854-2017876 GAGCCTCACCACAGCGGAGGAGG + Intronic
1143028943 17:3956801-3956823 AAGCCAGGTCACAGCGGAGGGGG - Intronic
1143731600 17:8885484-8885506 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1143731669 17:8885648-8885670 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1143731751 17:8885829-8885851 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1144590705 17:16521214-16521236 GAGACGGGGCAAAGCGGAGAGGG - Intergenic
1145752447 17:27364953-27364975 GAGGCTGGGCACAGTGGTGGAGG - Intergenic
1145868628 17:28256357-28256379 GAGGAGGGCCAGGGAGGAGGAGG - Intergenic
1146017646 17:29246835-29246857 GAGGAGGGCCACAGAGCAAGTGG + Intergenic
1146797831 17:35795382-35795404 GAGCCGGGCTGCACCGGAGGCGG - Exonic
1148128078 17:45247066-45247088 GAGGCGGGCCACAGCGGAGGAGG - Exonic
1148664186 17:49362179-49362201 GGGGCGGGCGGCAGGGGAGGGGG + Intronic
1148887907 17:50786841-50786863 TAGGGTGGCCGCAGCGGAGGTGG - Intergenic
1151673803 17:75588105-75588127 GAGGCCGGCCTCAGGGGAGCAGG + Intergenic
1151745400 17:76009154-76009176 GAGGCGGGCCGCGGAGGACGCGG - Exonic
1152394408 17:80023694-80023716 CAGGCGGGCCACCGAGGAGCAGG - Intronic
1152571392 17:81122765-81122787 GCAGCGGCCCACAGCCGAGGAGG - Exonic
1153627955 18:7039769-7039791 GATGAGGCCCACAGAGGAGGTGG + Intronic
1155386359 18:25282290-25282312 GAGGAGGGCCAGAGAGGAGTAGG + Intronic
1160143737 18:76347935-76347957 GAGGGGGGCAGCAGCTGAGGGGG - Intergenic
1160652257 19:237296-237318 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1160855334 19:1214755-1214777 GAGGTGGGCCAGAGCGGTGCTGG + Intronic
1160981872 19:1819938-1819960 GAGGCCGGGCACAGCGCTGGGGG + Exonic
1161084956 19:2330660-2330682 GAGCAGGGGCACAGAGGAGGGGG + Intronic
1161305361 19:3564345-3564367 GAGGGTGGCCACGGTGGAGGCGG + Intronic
1162396792 19:10421715-10421737 GAGGCAGGAAACAGTGGAGGGGG + Intronic
1162506783 19:11090408-11090430 GGGGCGGGCCAAAGGGGCGGGGG - Intronic
1162770729 19:12948100-12948122 GGGCGGGGCCACAGCGGAGCGGG + Intronic
1162932283 19:13963093-13963115 GAGGCGGGCCACTGGGGGCGCGG - Intronic
1162980453 19:14235805-14235827 GAGGCGGAGGACAGAGGAGGGGG - Intergenic
1163282150 19:16324756-16324778 GGGCCGGGCCAAAGCGGCGGCGG - Intergenic
1163444934 19:17340713-17340735 GGGGCGGGGCACAGCACAGGAGG - Intronic
1163444963 19:17340825-17340847 GGGGCGGGGCACAGTGCAGGGGG - Intronic
1163815509 19:19462455-19462477 GAGGCAGGCCACTGCGGGGCGGG - Intronic
1164434630 19:28218866-28218888 CAGGAGGGGCACAGCTGAGGTGG + Intergenic
1165783683 19:38448367-38448389 GTGGCTGGCCCCAGCGCAGGTGG - Exonic
1166144645 19:40825871-40825893 GAGGTGGGGCAGGGCGGAGGGGG - Intronic
1166555231 19:43695111-43695133 GAAGGGGGCCACAGCTGTGGAGG - Intergenic
1166748954 19:45155679-45155701 CAGGCTGGCCACAGGGGTGGGGG + Intronic
1166938609 19:46349920-46349942 AAGTGGGGCCACAGCGTAGGAGG + Intronic
1167609975 19:50502275-50502297 GAGGGTCCCCACAGCGGAGGAGG - Intergenic
1168639317 19:58020252-58020274 GAGGCTGGCCAGTGTGGAGGAGG + Intergenic
1168713207 19:58513276-58513298 TAGGCAGGCCACATCTGAGGTGG - Intergenic
925070869 2:965572-965594 GGAGGGGGCCACAGAGGAGGAGG - Intronic
926130963 2:10302903-10302925 CAGGCGGGCCGCGGCGGCGGCGG + Intronic
927887589 2:26728188-26728210 CAGGCGGGCGGCGGCGGAGGGGG + Exonic
931288759 2:60854221-60854243 GGGGAGGTCCACAGCGGAGTGGG + Intergenic
934090897 2:88549759-88549781 GATGCTGGCCAAAGAGGAGGAGG - Intergenic
934566214 2:95343032-95343054 GAGGAGAACCACAGTGGAGGTGG + Intronic
934615535 2:95768380-95768402 GAGGCAGGCCAGAGGGGATGGGG + Intergenic
934645364 2:96056178-96056200 GAGGCAGGCCAGAGGGGATGGGG - Intergenic
934838769 2:97612267-97612289 GAGGCAGGCCAGAGGGGATGGGG - Intergenic
934966856 2:98731113-98731135 GGGGCGGCCCGCAGCGGCGGCGG - Intronic
937062502 2:118990990-118991012 CAAGTGGGCCACAGCTGAGGTGG - Intronic
937223303 2:120354107-120354129 GAGCCCGGCCACAGCGCAAGAGG - Intergenic
937992517 2:127672537-127672559 GAGGTGGGCCACAGAGGGTGGGG - Intronic
938115949 2:128603046-128603068 CTGGCCTGCCACAGCGGAGGAGG + Intergenic
938416197 2:131105518-131105540 GAGTGGGGACACCGCGGAGGTGG - Intronic
939900503 2:147844598-147844620 GCGGCGGGCGGCAGCGGCGGCGG - Exonic
943661490 2:190563890-190563912 GGGGCTGGCCCCAGGGGAGGCGG + Intergenic
946252887 2:218424195-218424217 GAGGAGGGCCCAAGGGGAGGAGG - Intronic
948518685 2:238522300-238522322 GAGGGGGGCCACAGCCGAAGAGG - Intergenic
1169143253 20:3237826-3237848 CAGGCGGGCCAGAGGCGAGGAGG + Intronic
1169801240 20:9514733-9514755 GAGGCGGGGGACAGAGAAGGGGG - Exonic
1169867713 20:10218746-10218768 GGGGCGGGGCACGGCGGGGGCGG - Intergenic
1170457662 20:16548437-16548459 GAACCGGGCCACACAGGAGGAGG + Intronic
1170458286 20:16553764-16553786 GACGCTGGCTACAGCGGGGGAGG + Intronic
1170742013 20:19066432-19066454 GAAGTGGGCCACAGTGCAGGAGG + Intergenic
1171508641 20:25661103-25661125 GAACCGGGCCACAGAGCAGGAGG - Intergenic
1172097584 20:32467847-32467869 GAGGAGGCACACAGGGGAGGGGG + Intronic
1172278200 20:33692377-33692399 GACCAGGGCCACAGCGAAGGTGG + Intergenic
1172951630 20:38726411-38726433 GTCGCGGGGCACAGCGAAGGCGG - Intronic
1173003643 20:39123484-39123506 GACAAGGGCCACAGAGGAGGGGG - Intergenic
1173649306 20:44652847-44652869 GAGGCGGGCCAGAGGGGCAGAGG - Intergenic
1174870135 20:54174094-54174116 GACGCGGGACCCAGGGGAGGGGG + Intergenic
1175379289 20:58551802-58551824 GACGCAGGCCACAGCGCAGAAGG - Intergenic
1176018672 20:62951920-62951942 GAGGTGGGCCCTAGTGGAGGTGG + Intergenic
1176054298 20:63135589-63135611 GAGGCGGGGCCCAGAGGGGGCGG + Intergenic
1178672929 21:34607835-34607857 GAAGCGGGCCACACAGCAGGAGG + Intronic
1179926853 21:44539446-44539468 GAGGAGGGACACGGAGGAGGAGG + Exonic
1179928368 21:44550757-44550779 GAGGAGGGACACAGAGGAGGAGG + Exonic
1179929556 21:44558233-44558255 GAGGAGGGACACGGAGGAGGAGG + Exonic
1179931653 21:44574828-44574850 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179932569 21:44579907-44579929 GAGGAGGGACACGGAGGAGGAGG + Exonic
1179934115 21:44591564-44591586 GAGGAGGGACACGGAGGAGGAGG + Exonic
1179935516 21:44601535-44601557 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179937057 21:44612714-44612736 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179939284 21:44627851-44627873 GAGGAGGGACACAGAGGAGGAGG - Exonic
1179940770 21:44637974-44637996 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179942123 21:44647156-44647178 GAGGAGGGACACAGAGGAGGAGG - Exonic
1179948699 21:44697773-44697795 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179949643 21:44702602-44702624 GAGGAGGGACACAGAGGAGGAGG - Intronic
1180956141 22:19742246-19742268 GAGGCGGGACATGGCCGAGGTGG - Intergenic
1180994660 22:19959544-19959566 GGGGCGGGGCGGAGCGGAGGTGG + Intronic
1181051020 22:20238309-20238331 GGGGCGGGCCACTGCGGCGGCGG - Intergenic
1184334943 22:43847585-43847607 GAGGCTGGCCAGAGAAGAGGGGG - Intronic
1184656936 22:45946625-45946647 GAGGGGGACCACAGCAGTGGAGG + Intronic
1184741740 22:46432443-46432465 GAAGCGGGGCACAGCGGGGGTGG + Intronic
1184788044 22:46681214-46681236 GAGCCGGGCCATGGAGGAGGCGG + Intergenic
1184949854 22:47833497-47833519 GAGGAGGGCCACAGCTGTGAAGG + Intergenic
949522339 3:4868587-4868609 GAGGCGGGGCACGGAGGGGGCGG - Intronic
954314488 3:49793807-49793829 GAGACGGTCCACAGCAAAGGTGG + Exonic
959536612 3:107493403-107493425 GAGGCTGCCCACAGTGCAGGAGG - Intergenic
961331783 3:126146948-126146970 GAGGCTGGCCCCAGGGGAGCTGG + Intronic
965102664 3:164321144-164321166 GAGCCGGGCCACACAGCAGGAGG + Intergenic
966978082 3:185104130-185104152 AAAGCTGTCCACAGCGGAGGGGG - Intronic
967184228 3:186931208-186931230 GAGGCCCGCGGCAGCGGAGGGGG + Intronic
968365576 3:198182676-198182698 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
968946932 4:3669772-3669794 GAGGCGGCCCACGCCGGCGGGGG + Intergenic
971421990 4:26481884-26481906 GAGGCGGCGCTCTGCGGAGGCGG + Exonic
972290536 4:37686440-37686462 GAGGCGGGACCGAGCCGAGGTGG - Intergenic
972290591 4:37686639-37686661 GAGGCGGGGCCAAGCTGAGGTGG - Intergenic
973534655 4:51868336-51868358 GAGGTGGGCTGCAGTGGAGGAGG - Intronic
975640925 4:76499659-76499681 GGGACGGGCCACTGGGGAGGAGG + Intronic
979254610 4:118597843-118597865 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
979334351 4:119448188-119448210 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
983608068 4:169612642-169612664 AAGGCGGCACGCAGCGGAGGCGG + Intronic
984908301 4:184649524-184649546 GGGACGGGCCGCAGCGGAGGCGG - Intergenic
984918479 4:184743799-184743821 GAGGCTGGCCATAGGGGAGAAGG + Intergenic
985486841 5:156624-156646 GAGGAGGCCCACAACCGAGGCGG - Intronic
985938104 5:3112011-3112033 CAGGCTGGCCAGAGCAGAGGTGG - Intergenic
988823952 5:34915831-34915853 GCGGCACGCCACAGCAGAGGAGG + Exonic
997473507 5:134129786-134129808 GGGGCCTGCCACAGCGGAGGTGG - Intronic
1002668577 5:180846292-180846314 GAGGATGGCCACAGCTCAGGTGG - Intergenic
1003101198 6:3177627-3177649 TAGGCAGGCCAGAGCGGAGCCGG - Intergenic
1003107465 6:3227463-3227485 TGGGCGCGCCGCAGCGGAGGGGG - Intronic
1003801776 6:9678347-9678369 GAGGCTGGCCACACAGGAGATGG + Intronic
1008030658 6:46689472-46689494 GAGCCAGGCAACAGAGGAGGAGG + Exonic
1013467693 6:110431540-110431562 GTGGAGGGTCACAGCCGAGGAGG + Intronic
1018441731 6:163820106-163820128 GAGCCAGCCCACAGCCGAGGTGG - Intergenic
1022510325 7:30931319-30931341 GAGGCTGGTCACAGGGGATGTGG + Intergenic
1023463791 7:40430880-40430902 GAGGCGGGCCTCAGCACTGGAGG + Intronic
1023905184 7:44516835-44516857 GAGGCAGGAGACAGCGAAGGTGG + Exonic
1023937118 7:44748418-44748440 GGGGCGGGCCCCGGCGGAGGAGG - Intergenic
1024069705 7:45775509-45775531 GAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1026360534 7:69598380-69598402 GAGGCGGGCGGCGGCGGCGGCGG + Intergenic
1026734744 7:72942434-72942456 GATGGGAGCCACAGCAGAGGTGG - Exonic
1026785078 7:73297346-73297368 GATGGGAGCCACAGCAGAGGTGG - Intergenic
1026879946 7:73901812-73901834 GAGGCGGGACAGTGAGGAGGAGG - Intergenic
1027109001 7:75422584-75422606 GATGGGAGCCACAGCAGAGGTGG + Exonic
1029273766 7:99392539-99392561 CAGACGGGCCACAGCGAGGGAGG - Intronic
1032047091 7:128619794-128619816 AAGGCTGGCCAAAGGGGAGGTGG - Intergenic
1032076524 7:128838649-128838671 CCGGCGGGACACAGTGGAGGTGG + Exonic
1035183460 7:157107754-157107776 GAGGCTGGCCACATGGGAGACGG - Intergenic
1037579551 8:20236460-20236482 GAAGAGGGCTAGAGCGGAGGTGG - Intergenic
1037735638 8:21563782-21563804 GAGGCTGGCCATAGAGGAGATGG - Intergenic
1042984094 8:74564667-74564689 GAGGCAGCCCACAGAGCAGGTGG - Intergenic
1043620982 8:82192282-82192304 GAGGCTGGACACTGCGGAGAAGG + Intergenic
1047316604 8:123740641-123740663 GAGGTGGGACACAGAGGACGTGG - Intergenic
1047346993 8:124038265-124038287 GGGGCAGACCATAGCGGAGGTGG - Intronic
1047470510 8:125167034-125167056 GAGGTGGGAGACAGTGGAGGAGG - Intronic
1048970964 8:139644810-139644832 GTGCCGGGGCCCAGCGGAGGTGG - Intronic
1049403310 8:142440559-142440581 CAGCAGGGCCTCAGCGGAGGTGG - Intergenic
1049541550 8:143211348-143211370 GAGGCGGTGCACGGGGGAGGCGG + Intergenic
1049541555 8:143211364-143211386 GAGGCGGGGCACAGGAGAGGCGG + Intergenic
1049568997 8:143359673-143359695 GAGGGGGGACACAGAGGAGGAGG + Intronic
1049699907 8:144005849-144005871 GACGGGGGCAAGAGCGGAGGGGG - Intronic
1053600503 9:39604222-39604244 GCGGCGGGCCGCAGCCGGGGTGG - Intergenic
1053858151 9:42358078-42358100 GCGGCGGGCCGCAGCCGGGGTGG - Intergenic
1054253026 9:62738162-62738184 GCGGCGGGCCGCAGCCGGGGTGG + Intergenic
1054567142 9:66772661-66772683 GCGGCGGGCCGCAGCCGGGGTGG + Intergenic
1057773103 9:97984243-97984265 GGGGCGGGCCAGGGCGGCGGAGG + Intronic
1059405954 9:114098487-114098509 GGGGCGGGGCACCGTGGAGGAGG + Intronic
1060491084 9:124084816-124084838 CAGGAGGGTCACAGGGGAGGTGG + Intergenic
1060700601 9:125746938-125746960 GCGGCGGGCGGCGGCGGAGGAGG - Intergenic
1060917101 9:127397879-127397901 GAGGCGGGCGGCTGCTGAGGAGG - Intronic
1060978408 9:127778828-127778850 GAGGCGGCCCACAGGGGCTGGGG - Intergenic
1061283497 9:129610170-129610192 GGGCCGAGCCACAGGGGAGGGGG + Intronic
1061777808 9:132977653-132977675 GAGGCGGGGGCCAGAGGAGGAGG + Intronic
1061793428 9:133070682-133070704 GCGGAGGGCCACAGCCGAGAAGG + Intronic
1062067497 9:134536632-134536654 GAGAGGGGCCACCGGGGAGGGGG - Intergenic
1062243180 9:135550507-135550529 GAGGCCGGCCACAGTGAGGGAGG + Intergenic
1062451827 9:136618966-136618988 GAGGCGGGTCCCAGGAGAGGAGG + Intergenic
1062659099 9:137619084-137619106 GCGGCGGGCAGCGGCGGAGGCGG + Intronic
1062749945 9:138245543-138245565 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1203775400 EBV:70239-70261 GAAGTCGGCCACAGGGGAGGTGG + Intergenic
1185499058 X:583995-584017 GAGGAGGGAGACAGAGGAGGAGG + Intergenic
1185662099 X:1735826-1735848 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662103 X:1735842-1735864 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662107 X:1735858-1735880 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662111 X:1735874-1735896 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662115 X:1735890-1735912 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662119 X:1735906-1735928 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662123 X:1735922-1735944 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662127 X:1735938-1735960 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662131 X:1735954-1735976 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662135 X:1735970-1735992 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185662139 X:1735986-1736008 GAGGAGGGAGAAAGCGGAGGAGG - Intergenic
1185667093 X:1774511-1774533 GAACCGGGCCACAGAGCAGGAGG - Intergenic
1186497240 X:10021346-10021368 GAGGCGGGCCTCACCTCAGGCGG - Intronic
1186768455 X:12794190-12794212 GAGGCTGGTCACAGCTGAGGCGG + Intronic
1188411721 X:29881050-29881072 GAGGAGGACCACAAGGGAGGGGG - Intronic
1192260115 X:69501130-69501152 GAGGCGGGTCACTCCTGAGGGGG - Intergenic
1194227619 X:91280361-91280383 GAGAGGGGACACAGTGGAGGTGG + Intergenic
1194977718 X:100410373-100410395 GGGGCGGGGCCAAGCGGAGGCGG + Intergenic
1195923092 X:110002352-110002374 GAGGCAGGCCAGGGAGGAGGCGG + Intergenic
1199561710 X:149170508-149170530 GAGGCAAGACACAGGGGAGGAGG - Intergenic
1199600914 X:149540572-149540594 GAGGCGGGGCTGAGAGGAGGAGG - Intronic
1201306116 Y:12552031-12552053 GAGGAGAGCCAGAGAGGAGGGGG - Intergenic