ID: 1148128649

View in Genome Browser
Species Human (GRCh38)
Location 17:45249349-45249371
Sequence CCTGGAAGGCTGAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148128641_1148128649 19 Left 1148128641 17:45249307-45249329 CCACGGTGCCTGTTGGGCTGGAG No data
Right 1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG No data
1148128642_1148128649 11 Left 1148128642 17:45249315-45249337 CCTGTTGGGCTGGAGCTGAAGAG No data
Right 1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148128649 Original CRISPR CCTGGAAGGCTGAGGGTAGA GGG Intergenic
No off target data available for this crispr