ID: 1148131767

View in Genome Browser
Species Human (GRCh38)
Location 17:45266576-45266598
Sequence CTCCAGCTGGAACATGGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148131767_1148131770 -10 Left 1148131767 17:45266576-45266598 CCAGCACCATGTTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1148131770 17:45266589-45266611 CCAGCTGGAGCTTCGAGCCTCGG 0: 1
1: 0
2: 1
3: 16
4: 138
1148131767_1148131772 5 Left 1148131767 17:45266576-45266598 CCAGCACCATGTTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1148131772 17:45266604-45266626 AGCCTCGGCCTGGCTGCTCCAGG 0: 1
1: 1
2: 2
3: 40
4: 331
1148131767_1148131776 25 Left 1148131767 17:45266576-45266598 CCAGCACCATGTTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1148131776 17:45266624-45266646 AGGAGTGTACGCCTGAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 113
1148131767_1148131777 26 Left 1148131767 17:45266576-45266598 CCAGCACCATGTTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1148131777 17:45266625-45266647 GGAGTGTACGCCTGAGCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 96
1148131767_1148131771 -5 Left 1148131767 17:45266576-45266598 CCAGCACCATGTTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1148131771 17:45266594-45266616 TGGAGCTTCGAGCCTCGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148131767 Original CRISPR CTCCAGCTGGAACATGGTGC TGG (reversed) Exonic
901601398 1:10426308-10426330 CTCCACCTGCAGCCTGGTGCAGG - Intergenic
902695690 1:18139399-18139421 CCCCTGCTGGAAGATCGTGCAGG + Intronic
905649350 1:39646228-39646250 CTCAGGATGGAACATGGAGCAGG - Intergenic
905940726 1:41861165-41861187 CCCCAGATGGAGCATGGTGTAGG - Intronic
906493515 1:46286334-46286356 CACCATCTGTAACATGCTGCAGG - Exonic
906810128 1:48818100-48818122 TTCCGGCTGGAAGATGGAGCTGG - Intronic
907436580 1:54453284-54453306 CTCCAGCTGTCACGTGGTTCTGG + Intergenic
907651039 1:56295061-56295083 CTGCGGCTGGAACAAGGTGTAGG - Intergenic
907716278 1:56929313-56929335 CTCCAGGTGGAAACTGGTGTAGG + Exonic
908056067 1:60288717-60288739 CTCCAGCTAGAGCATGGTAACGG + Intergenic
912491397 1:110064683-110064705 CTCCAGCTGGAATGTGCTGAAGG + Exonic
912690538 1:111801494-111801516 CTCCAGCTGGGACGTGGTTGAGG + Intronic
917575215 1:176314233-176314255 CTTCAGCTCGCGCATGGTGCGGG + Intergenic
919755822 1:201065891-201065913 CACCATCGGGAACATCGTGCTGG - Exonic
921095873 1:211886937-211886959 CCCCATGTGGAACATGGTGGTGG - Intergenic
921213485 1:212918882-212918904 GCCCAGCTGGTGCATGGTGCAGG + Intergenic
921675692 1:217973823-217973845 CCCCTGCTGGAAGATGGTGTGGG - Intergenic
922504912 1:226120861-226120883 GTTCAGCTGGAGCATGCTGCCGG - Intergenic
922725460 1:227920958-227920980 GTACAGCTGGAGCAGGGTGCCGG - Exonic
1064815030 10:19251399-19251421 CTCTAGCTGGAATAGGCTGCTGG - Intronic
1065756841 10:28938399-28938421 CTCCACCGGTAACATGGTGAGGG + Intergenic
1066366148 10:34778599-34778621 CTCCAGCAGAGACATGGTGGAGG + Intronic
1067987222 10:51163559-51163581 CTTCGGCTCGCACATGGTGCGGG - Intronic
1071277153 10:84065729-84065751 CTCCATCTGCAAAATGGTGGTGG - Intergenic
1072032974 10:91539061-91539083 CTCGAGCTGATACATGGGGCAGG - Intergenic
1074149626 10:110746584-110746606 CTCCAGGTGGAATTTGGTGCCGG - Intronic
1074549937 10:114433391-114433413 CTCCAGCTGGAGCCTTTTGCTGG + Intronic
1075334788 10:121600793-121600815 TTTCAGCTGAAACCTGGTGCTGG - Intergenic
1075389887 10:122084507-122084529 CTCCATCTGGCACAGGGGGCAGG - Exonic
1075800257 10:125149347-125149369 CTCCACCTGGAAGAGGGTGGTGG - Intronic
1076184434 10:128435212-128435234 TTCCAGCCGGAACTTGGGGCGGG + Intergenic
1076514094 10:131033456-131033478 CTCCAGCTGGTAAATGTGGCTGG - Intergenic
1076668861 10:132108209-132108231 CTCCAGCAGGACCAAGGTCCAGG - Intronic
1077299403 11:1840177-1840199 TGCCAGGTGGCACATGGTGCTGG - Intronic
1081568511 11:44275444-44275466 CTCCAGCTGGTAGCTGGTGAAGG + Exonic
1083896890 11:65624528-65624550 CTCCAGCAGGTACATGAGGCAGG - Exonic
1083956906 11:65988880-65988902 CTCCAGCTTGTAAATGCTGCTGG + Intergenic
1085196717 11:74677087-74677109 CTTCAGCTGGAAAATGGGGGTGG - Intergenic
1085619939 11:78030442-78030464 CTCCACCTGTAATATGGTGGGGG + Intronic
1088642766 11:111889396-111889418 CTCCCTCTGGAAAATGGTGAAGG - Intergenic
1088726176 11:112637150-112637172 ACCCAGCTGGGACATGCTGCTGG - Intergenic
1088881235 11:113975105-113975127 CTTCAGCTGGATCATGTTTCAGG - Exonic
1090784087 11:130033137-130033159 CTTCAGCTCGAACACCGTGCTGG + Intergenic
1091057189 11:132430202-132430224 CTCTAGCTGGGACATGGAGAGGG - Intronic
1091578391 12:1761770-1761792 TTCCAGATGGAAGATGGTGGTGG - Intronic
1091686953 12:2569389-2569411 CTACAACTAGAACATGGTGATGG - Intronic
1094074458 12:26457592-26457614 ATCCAGGTGAAAGATGGTGCTGG + Intronic
1097271835 12:57780313-57780335 CTCCAGCTGGCACATTGGCCTGG - Exonic
1098910504 12:76203975-76203997 CTCCAGAGGGATCATGGTGATGG + Intergenic
1102012585 12:109627753-109627775 GTGGAGCTGGAACTTGGTGCTGG - Intergenic
1102866409 12:116378480-116378502 CTACATCTGGAAAATGGGGCTGG + Intergenic
1103623517 12:122203207-122203229 CTCCCGCTGGGACAGGGTCCAGG + Intronic
1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG + Intronic
1104328264 12:127820330-127820352 CTGCAGCAAGAGCATGGTGCAGG + Intergenic
1104566557 12:129890230-129890252 ATCCATCTGGAACTTGGCGCAGG + Intronic
1106193680 13:27475693-27475715 CTGGAGATGGATCATGGTGCTGG - Intergenic
1106573621 13:30954007-30954029 ACTCAGCTGGAACATGGTGGAGG + Intronic
1109734744 13:66468060-66468082 ATCCAGCTGGAGCATGGAGGAGG - Intronic
1111048266 13:82845842-82845864 CTACATCTTGAATATGGTGCTGG + Intergenic
1112357394 13:98685356-98685378 CTGCTGCTGGGACCTGGTGCAGG + Intronic
1117334903 14:54748896-54748918 CTCCAGCTGGCACTCGGTGAGGG - Exonic
1119777001 14:77255511-77255533 ATCCAGGTGGAACATTCTGCAGG - Intronic
1120912541 14:89680654-89680676 CTCCATCTGAAAAAAGGTGCTGG - Intergenic
1121267584 14:92614295-92614317 CTCCAGGAGGAACATGGGTCTGG - Intronic
1121644054 14:95505776-95505798 CTCTATCTGGATAATGGTGCTGG + Intergenic
1122037168 14:98957263-98957285 CTCCAGCCAGAACATGGTAGCGG - Intergenic
1122859808 14:104577469-104577491 CTCCAGCCAGACCATGGTCCAGG + Intronic
1122901974 14:104785777-104785799 CCCCGGGAGGAACATGGTGCGGG + Intronic
1122904899 14:104797126-104797148 CCCCAGGTGGCTCATGGTGCAGG - Intergenic
1124940577 15:34213858-34213880 CACCAGGTGGAACGTGGTGGGGG + Intergenic
1127903011 15:63354957-63354979 CTCCAGAAGGAACCTGATGCAGG - Intronic
1129275502 15:74442745-74442767 CTCCAGATGGGACATGGAGGGGG - Intergenic
1129681215 15:77659499-77659521 CCACAACTGGAACATGGTTCTGG - Intronic
1129885146 15:79032117-79032139 CGCCACCTGGAACATGGGGTAGG + Exonic
1130486902 15:84403138-84403160 CTACAGCTGGATCCTGCTGCAGG - Intergenic
1131117564 15:89804288-89804310 CTCCAGCAGCAACAAGGAGCGGG - Exonic
1133170368 16:3979224-3979246 CTCCAGCAGGCGCTTGGTGCAGG + Exonic
1135335674 16:21599491-21599513 CTCCGGATGGAAACTGGTGCAGG + Exonic
1135477201 16:22787197-22787219 CTGCAGCTGGATGATGGTGATGG - Intergenic
1136343567 16:29661353-29661375 ATGCAGCTGGAAGATGGTGGTGG + Intergenic
1136382933 16:29905066-29905088 ATGCAGCTGGAAGATGGTGGTGG - Intronic
1138247463 16:55478507-55478529 CTCCATCTTGAACAGGGGGCTGG - Intronic
1138420040 16:56892986-56893008 CTCCGACTGGAAGATGGTGGTGG - Exonic
1138599634 16:58046935-58046957 CTCCAGCTGGAAGGGCGTGCAGG + Intergenic
1138886995 16:61091514-61091536 CTCCAGCTGGCATCTGGAGCGGG + Intergenic
1139365245 16:66428618-66428640 CCCCATCTGGAACATGGGGAAGG + Intronic
1139431907 16:66915254-66915276 CTCCAGCTGGAACATGTCTGGGG + Exonic
1141201106 16:81898500-81898522 CTTGAGCTGGAACATGGTTAAGG + Intronic
1142360655 16:89624979-89625001 TTCCATCTGGGACATGGTGGTGG + Intronic
1142426571 16:90004760-90004782 CTGCAGCTGGAGAATGGTCCGGG + Intergenic
1143278268 17:5730838-5730860 CTCCTGCTGGGACTTGCTGCTGG - Intergenic
1145811892 17:27769253-27769275 CTCCAGCTGGAGAATGGAGCTGG + Intronic
1148131767 17:45266576-45266598 CTCCAGCTGGAACATGGTGCTGG - Exonic
1148135650 17:45290086-45290108 CTCTAGGTGGAAGATGGTGAAGG + Intronic
1150151387 17:62811563-62811585 CTCTACCAGGAACATTGTGCAGG - Intergenic
1150285431 17:63951313-63951335 CTCCAGCTGTAAAATGGGGGTGG - Intronic
1152659608 17:81536151-81536173 CTCCATCTCAAACATGGTGTTGG - Exonic
1153170369 18:2309519-2309541 CTCCATCTGCAAAATGGAGCTGG - Intergenic
1153637656 18:7127144-7127166 CTCCAACTCCACCATGGTGCAGG + Intergenic
1154044923 18:10895524-10895546 CCCCAGCTGGAACAGAGTGCCGG + Intronic
1154427978 18:14286729-14286751 CAGCAGCTGGGCCATGGTGCTGG - Intergenic
1154430691 18:14306239-14306261 CAGCAGCTGGGCCATGGTGCTGG - Intergenic
1156329582 18:36107137-36107159 CTCCAGCTGGAACCTGTTAACGG - Intergenic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1159359990 18:67387829-67387851 CTCCAGCTGGAAATTTCTGCAGG + Intergenic
1160081162 18:75728542-75728564 CTCCAGCCTGAACATGAGGCAGG - Intergenic
1160774851 19:850718-850740 TTGCAGCTGGAACATCGTGGGGG + Intergenic
1160837612 19:1132120-1132142 CTGCAGCTGGGACATGGTCCCGG + Intronic
1161006099 19:1937507-1937529 CTCCAGCTGTAACAGGCGGCAGG + Intergenic
1161515110 19:4692112-4692134 CCCCGGCTGGAACAAGATGCTGG + Intronic
1163392619 19:17039533-17039555 CTCCTGCTGGATCATGGTGGTGG + Intergenic
1165150450 19:33757057-33757079 CTCCTGCTGCTACAGGGTGCTGG + Intronic
1165455713 19:35909429-35909451 CCCCAGCTGGAGCCTGGGGCTGG + Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165735858 19:38175135-38175157 CCCCACCTGGAACATGGAGGTGG + Intronic
1165773269 19:38390290-38390312 CTCCTGCAGGTACATGGTGCGGG + Exonic
1168287846 19:55343251-55343273 TCCCAGCTGGTACATGCTGCAGG + Intronic
927185616 2:20480039-20480061 CCCCAGCTGGAGCATGGACCAGG - Intergenic
928317252 2:30255809-30255831 CCCCATCTGGATCAAGGTGCAGG + Intronic
932489249 2:72109489-72109511 ACACAGCTGGAACGTGGTGCTGG - Intergenic
941670097 2:168283944-168283966 CTCCAGCTTGAGCATGGTAGAGG - Intergenic
943339548 2:186663089-186663111 CTCTAGCTGGAACATTCTCCTGG + Intronic
944788372 2:203097646-203097668 CTTCAGCTGAAACAAGATGCAGG - Intronic
946027977 2:216683600-216683622 CTCCAACTGGAAAATGATCCAGG + Intronic
946219942 2:218217463-218217485 CTCCAGCAGGATCATGGCGGCGG - Exonic
946395215 2:219440499-219440521 CTCCAGCCCAAACATTGTGCAGG + Intronic
947924099 2:233905833-233905855 CTCCTTCAGGAACATGGTGGAGG + Intergenic
948280126 2:236740659-236740681 CTCCCGCTGGACCGTGCTGCAGG + Intergenic
1168860526 20:1043219-1043241 CTCCAGTGAGAAAATGGTGCAGG - Intergenic
1172334068 20:34099419-34099441 CTTCAGCAGGAACAGGGTTCAGG + Intronic
1175116283 20:56684875-56684897 CTCCAGCGGGGACATGGACCAGG - Intergenic
1177008409 21:15702331-15702353 CACCAGCTGGAATAAGGTTCTGG - Intergenic
1177235316 21:18382415-18382437 CAGCAGCTGCAACATGTTGCAGG + Intronic
1177684901 21:24423161-24423183 CTATAGCTGGAACATGGTTTGGG - Intergenic
1181952581 22:26565094-26565116 CTCTAGCTGCAACATGGGCCAGG + Intronic
1183083579 22:35472907-35472929 CTCGAGCTGGAGGATGGTGCTGG + Intergenic
1183335311 22:37242903-37242925 TTCCAGCTAGAACATGCTCCAGG + Intronic
949876251 3:8627901-8627923 CTTCATCTGTAAAATGGTGCGGG + Intronic
950933011 3:16809821-16809843 CTTCAGCTGGAATGTGGTGGGGG + Intronic
953980157 3:47409612-47409634 CTCCAGGTGAACCATGGGGCTGG - Intronic
955431427 3:58849164-58849186 CTCCAACTGGAAGAAGGTGTGGG - Intronic
957938838 3:86978450-86978472 CTCCAGCTGGAACCTGGTACAGG + Intronic
958060089 3:88468357-88468379 TTCCAGCTGGAGCATGATACAGG + Intergenic
960595226 3:119402152-119402174 CTCCATCTGGAAGAGGCTGCTGG - Exonic
960618395 3:119616932-119616954 CTCCAGTTGCAACAGGGAGCTGG - Intronic
960701998 3:120448738-120448760 CTCCAGCAGGAAATTGCTGCTGG + Intronic
962377125 3:134867622-134867644 CTCCAGCTTCAACTTGGTGATGG + Intronic
963930934 3:151003736-151003758 ATCCAGCTGGCAGATGGTGGTGG + Intergenic
964646382 3:158962609-158962631 ATCTAACTGGAACATGGTGGGGG - Intronic
965256851 3:166424345-166424367 CTCCACCTGCAGCCTGGTGCGGG + Intergenic
967763397 3:193250846-193250868 CTCCAATTGGAAAAAGGTGCGGG - Intronic
968684933 4:1951680-1951702 CTCCAGCTGACAGATGGGGCGGG - Intronic
969846594 4:9924597-9924619 CTCCAGCTGGGAAATGGGACAGG - Intronic
974083254 4:57234094-57234116 CTCCATCTGCAGCATGGGGCGGG - Intergenic
975610561 4:76198580-76198602 CCCCAGCTGTAACATGGTCTGGG - Intronic
976906685 4:90245375-90245397 CCTCAGCTGAAACAAGGTGCTGG + Intronic
977371544 4:96143397-96143419 CTGCATCTAGCACATGGTGCAGG + Intergenic
978884446 4:113750307-113750329 CTCCATCAGGAAGATGGAGCAGG + Intronic
980495573 4:133585158-133585180 CTCAAGCTGGAAGGTGTTGCTGG + Intergenic
981047817 4:140281628-140281650 ATCCAGCTGGAAGCAGGTGCTGG + Intronic
982165529 4:152610367-152610389 CTCCAGCTGGCATATAGTCCTGG + Intergenic
984891725 4:184499955-184499977 CTCCAGCTTACACATGGTGGTGG - Intergenic
985666695 5:1184741-1184763 CCCCAGCTGGAAGATGGGGCTGG + Intergenic
985754226 5:1703643-1703665 GTCCAGGAGGATCATGGTGCTGG - Intergenic
986631796 5:9781378-9781400 GTCCAGGTGAGACATGGTGCTGG - Intergenic
987262883 5:16221421-16221443 CTCCAGCTGGAGCAGGGACCTGG - Intergenic
987811998 5:22849082-22849104 CCACAGCTGGAACATGGGGTTGG - Intronic
989256302 5:39369294-39369316 CTCCAGCAAGACCATGGTGTGGG - Intronic
989473597 5:41849121-41849143 CTCCAGATGGAAGATGCAGCTGG + Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993738147 5:91502431-91502453 TGCCAGCTGGAACATGGGCCAGG - Intergenic
1003265255 6:4560264-4560286 CACCAGCTGTGACATGGTGAAGG + Intergenic
1007242870 6:40439556-40439578 CTGGAGCTGGCACATGGTGCTGG - Intronic
1008128954 6:47698813-47698835 CTTCAACAGGAAAATGGTGCTGG - Intronic
1012145098 6:95670455-95670477 CTCCGCCTGGGCCATGGTGCAGG + Intergenic
1019172337 6:170139738-170139760 CTGGAGCTGGAAGAGGGTGCAGG - Intergenic
1022165008 7:27750222-27750244 TTCCAGCAGGAAAATGGTACAGG + Intronic
1022523211 7:31020948-31020970 CTCCAGGTGGAACAGGATGGAGG + Intergenic
1023156095 7:37253881-37253903 CTCCAGCTGGAACATTGCCCAGG + Intronic
1023893839 7:44415677-44415699 CTCCAGCTGTAGCTTGATGCAGG - Intronic
1028525628 7:91782653-91782675 TTCCAGGTGGAAGATGGTGGTGG - Intronic
1028554272 7:92105423-92105445 CTCAAGCTGGAACCTGATGCTGG + Intronic
1033509158 7:142037363-142037385 CTACAGCTTGAACATAGTTCTGG - Intronic
1034432926 7:151049948-151049970 CTCCAGTGGGCACATGTTGCAGG - Intronic
1035122606 7:156580786-156580808 CTACAGCTGGTACGTGGTGAGGG + Intergenic
1035322666 7:158043543-158043565 CTCCTGCAGGAGCTTGGTGCTGG - Intronic
1039347437 8:36723062-36723084 GTTCACCTGGAACATGTTGCTGG - Intergenic
1043833964 8:85024438-85024460 CTCCATATGTAACATGGTTCTGG - Intergenic
1045331140 8:101156820-101156842 CTGCTGCTGGAACATTGTGCTGG + Intergenic
1047206224 8:122804719-122804741 CCTCAGCTGGGAAATGGTGCAGG - Intronic
1048254648 8:132896532-132896554 CTCCTGCTGGCACTTGGGGCAGG - Intronic
1048432319 8:134381912-134381934 CTGCTGCTGGAACATGTTTCTGG - Intergenic
1049040980 8:140111435-140111457 CTGCCTCTGGAACATGGTGGGGG + Intronic
1049318236 8:141981066-141981088 GCTGAGCTGGAACATGGTGCTGG + Intergenic
1049632150 8:143664658-143664680 CACCAGCTGGTAGGTGGTGCGGG - Intergenic
1049653980 8:143789707-143789729 CTCCAGCCAGAGCATGGGGCAGG + Intergenic
1049850735 8:144828912-144828934 CTCTAGCAGGGACATGGGGCTGG - Intronic
1050621413 9:7456042-7456064 TTCCAGCTCCAACATGGTCCTGG - Intergenic
1050643130 9:7690682-7690704 TTCTAGCTGGAACATAATGCAGG - Intergenic
1051209920 9:14730498-14730520 CTCCAGTTGGAGCATGGGGGTGG + Intergenic
1051383377 9:16480920-16480942 CTCCACCTGCAGCCTGGTGCGGG + Intronic
1052956476 9:34256433-34256455 CTCCAGGAGGGACATGGTGAGGG + Exonic
1053202584 9:36163014-36163036 TTCCATCAGGAACATGGAGCAGG + Exonic
1055834812 9:80426520-80426542 CACCAGCTGGAACAGCGTTCTGG + Intergenic
1056080889 9:83093246-83093268 CTCCACCTGCAGCCTGGTGCGGG - Intergenic
1056383578 9:86077442-86077464 CTCCAGCTGGAAGTTGTGGCTGG + Exonic
1057118239 9:92545658-92545680 CTCCACCTGCAGCCTGGTGCGGG + Intronic
1059355898 9:113699137-113699159 CTGCAGTTGGAACATGGTAGAGG + Intergenic
1059477315 9:114557868-114557890 CTCCATCTTGAATATGGGGCTGG - Intergenic
1060684045 9:125592075-125592097 CACCAGCTGAAACATGATGCTGG + Intronic
1061022183 9:128023082-128023104 ATCCAGCTGGCAGATGGGGCAGG - Intergenic
1062395334 9:136350482-136350504 CTCCAGCTGGGCCAAGGTACTGG + Intronic
1185702953 X:2245106-2245128 GTCCAGCTGGAACCTGCTGAAGG + Intronic
1185929106 X:4182235-4182257 CTCCATCTTGAACAGGGGGCTGG - Intergenic
1197625713 X:128800183-128800205 ACCCAGCTAGGACATGGTGCAGG + Intergenic
1197891539 X:131274822-131274844 CCCTAACTTGAACATGGTGCTGG + Exonic
1199164465 X:144654446-144654468 CTACAGTTGGTACATGGTGTAGG + Intergenic
1199203475 X:145120742-145120764 CTCCAGCTGGAAAACAGTTCTGG - Intergenic