ID: 1148132541

View in Genome Browser
Species Human (GRCh38)
Location 17:45270743-45270765
Sequence CTGGCTCTGGCCTGTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148132541_1148132545 3 Left 1148132541 17:45270743-45270765 CCAGTAAAACAGGCCAGAGCCAG 0: 1
1: 0
2: 1
3: 32
4: 180
Right 1148132545 17:45270769-45270791 GCAAGACGCCCACAGCCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 169
1148132541_1148132549 17 Left 1148132541 17:45270743-45270765 CCAGTAAAACAGGCCAGAGCCAG 0: 1
1: 0
2: 1
3: 32
4: 180
Right 1148132549 17:45270783-45270805 GCCTCCAGGCCCGGCCCGTTAGG 0: 1
1: 0
2: 0
3: 34
4: 373
1148132541_1148132551 20 Left 1148132541 17:45270743-45270765 CCAGTAAAACAGGCCAGAGCCAG 0: 1
1: 0
2: 1
3: 32
4: 180
Right 1148132551 17:45270786-45270808 TCCAGGCCCGGCCCGTTAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 70
1148132541_1148132553 24 Left 1148132541 17:45270743-45270765 CCAGTAAAACAGGCCAGAGCCAG 0: 1
1: 0
2: 1
3: 32
4: 180
Right 1148132553 17:45270790-45270812 GGCCCGGCCCGTTAGGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1148132541_1148132556 27 Left 1148132541 17:45270743-45270765 CCAGTAAAACAGGCCAGAGCCAG 0: 1
1: 0
2: 1
3: 32
4: 180
Right 1148132556 17:45270793-45270815 CCGGCCCGTTAGGAGGCAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 403
1148132541_1148132546 8 Left 1148132541 17:45270743-45270765 CCAGTAAAACAGGCCAGAGCCAG 0: 1
1: 0
2: 1
3: 32
4: 180
Right 1148132546 17:45270774-45270796 ACGCCCACAGCCTCCAGGCCCGG 0: 1
1: 0
2: 1
3: 38
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148132541 Original CRISPR CTGGCTCTGGCCTGTTTTAC TGG (reversed) Intronic
900004837 1:38035-38057 CAGGCTCTGGGCTGTGTTACTGG - Intergenic
900662140 1:3790121-3790143 CTGACTCTGGCCTGGCATACCGG + Intronic
900691822 1:3985318-3985340 CTTTGTCTGTCCTGTTTTACAGG - Intergenic
901399175 1:9004471-9004493 CTGGCTCTGGCTTTGTTTGCTGG + Intronic
901677925 1:10897680-10897702 AGGGCTCTGGCCTGTTTTTCCGG + Intergenic
902393149 1:16117910-16117932 CTGGCTTTGGCCTGTTGTCCTGG - Intergenic
903261978 1:22136433-22136455 CTGGCTCTGGACAGTTCTGCTGG - Intronic
904266880 1:29323376-29323398 CTGGCTCTGGCCAGTACTGCAGG - Exonic
905119802 1:35672880-35672902 CTGGCTCTGACCTGAATGACAGG - Intergenic
905759382 1:40541482-40541504 CTGGGTCTGTTCTGTTTTAAAGG + Intronic
907564805 1:55424883-55424905 CTGGCTCTGCCTTTTGTTACTGG - Intergenic
909008206 1:70302210-70302232 CTGGCTCACCCCTGTTTTCCTGG - Intronic
912576952 1:110680813-110680835 CTGGCTCTGACCTGTCATTCTGG + Intergenic
915389121 1:155524977-155524999 GTGGCTCACGCCTGTATTACTGG + Intronic
916889444 1:169102335-169102357 CTGGCACTTTCCTATTTTACTGG - Intergenic
919875054 1:201859329-201859351 CGGCCTCTGGGCTGTTTTAGAGG - Intronic
919928121 1:202203223-202203245 CTGCCTTTGGCCTGTTTCTCAGG - Intronic
921489717 1:215760281-215760303 ATGCCTCTGGCCTCATTTACTGG + Intronic
921945706 1:220884630-220884652 CTGGCTGTGGGCTGTGTTGCAGG - Exonic
923834474 1:237594725-237594747 CTGGCTTTAGCCTTTTTTGCTGG + Intronic
924027134 1:239845760-239845782 CAGCCTCTGGCCTGTTTTCATGG + Intronic
1062813273 10:481204-481226 CTGGCCCTGGCCTGTTCACCTGG - Intronic
1063136951 10:3225720-3225742 CTGTCTCTGGTATGTTTTCCTGG + Intergenic
1064205782 10:13322412-13322434 GTGGCTCTTGCCTGTAATACTGG - Intronic
1065183083 10:23146152-23146174 CTGGCTCTGTCATTTTTTTCTGG - Intergenic
1066355455 10:34679306-34679328 CTACCTCCGGCCTGTTTGACTGG - Intronic
1068064634 10:52113592-52113614 CTGACTGTGTCCTGTTCTACAGG + Intronic
1069051739 10:63802563-63802585 CCATCTCTGGGCTGTTTTACAGG + Intergenic
1072691579 10:97575518-97575540 GTGGCTCAGGCCTGTTGTCCTGG + Intronic
1074225647 10:111481600-111481622 CTGGCTCTGACCTGATCTATGGG - Intergenic
1075737787 10:124674664-124674686 CTGGCTCTTGCCCCTTTGACTGG - Intronic
1076277097 10:129210141-129210163 GTGGCTCAGGCCTGTTGTCCCGG - Intergenic
1076606878 10:131695038-131695060 CTGGCTCAGGCCTGGATCACAGG + Intergenic
1080416974 11:32077904-32077926 CTGGCACTGGCATCTTTTATTGG + Intronic
1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG + Intergenic
1080698746 11:34625748-34625770 CTGTCTTTGGTTTGTTTTACGGG + Intronic
1084891352 11:72238608-72238630 CTGGTGCTGTCCTGTTTTACTGG + Exonic
1085131257 11:74040804-74040826 GTGGCTCAGGCCTGTTGTCCTGG + Intronic
1085467670 11:76735239-76735261 CTGGGCCTGGCTTCTTTTACAGG - Intergenic
1085821203 11:79795518-79795540 CTGGTTCTGGGCTGTTGTGCAGG - Intergenic
1088134006 11:106531651-106531673 GTGGCTCAGGCCTGTTGTCCTGG - Intergenic
1088664872 11:112084694-112084716 CTGGAGATGGCCTGTTCTACTGG - Exonic
1089372452 11:117971014-117971036 CTGGCTCTGGCAGGTTGTGCAGG - Intergenic
1091378247 12:40085-40107 CAGGCTCTGGGCTGTGTTACTGG - Intergenic
1091953821 12:4619288-4619310 GTGGCTCATGCCTGTTTTCCTGG + Intronic
1092399127 12:8157890-8157912 CTTCCTCTGGCCTTTGTTACAGG + Intronic
1095811799 12:46379981-46380003 CTGACTTTGGCATGTTTTTCTGG + Intergenic
1101886453 12:108667612-108667634 GTGGCTCAGGCCTGTTGTCCTGG + Intronic
1105931340 13:25055685-25055707 CTGGCACTGAGCTGTTTTCCTGG + Intergenic
1106244867 13:27940503-27940525 GTGGCTCAGGCCTGTTGTCCTGG + Intergenic
1106295817 13:28412828-28412850 GTGGCTCTGGCCTGTAATCCTGG - Intronic
1109902818 13:68795844-68795866 CTGGCTTTGGCCTCCTTTCCAGG + Intergenic
1110401612 13:75098301-75098323 CTGGCTCTGCCGTGTATCACTGG + Intergenic
1111351489 13:87036839-87036861 CTGTTTCTGGCCAGTTTCACAGG + Intergenic
1112431528 13:99354698-99354720 CTGAGTCTGTCCTGTTTTGCAGG - Intronic
1113033729 13:106025050-106025072 TTGGGTCTGGCTTATTTTACTGG - Intergenic
1117769422 14:59118099-59118121 CTGGCTCTGGCAGGTTTTACAGG + Intergenic
1118643303 14:67814009-67814031 CTGGGTCTGGCTTCTTGTACTGG - Exonic
1121652257 14:95567182-95567204 CGATCTCTGGCCTGTTTTATGGG + Intergenic
1123008968 14:105338108-105338130 CTGGCGCTGGCCCGGTTTCCTGG + Intronic
1123419650 15:20121255-20121277 CTGGTTCTGGCCAGTTTTAGAGG - Intergenic
1123446214 15:20332281-20332303 CTGGTTCTGGCCAGTTTTAGAGG + Intergenic
1123528873 15:21127791-21127813 CTGGTTCTGGCCAGTTTTAGAGG - Intergenic
1125824142 15:42661259-42661281 CTTGTTCTTGCCTGTTTTACAGG + Intronic
1132013501 15:98296353-98296375 CTGGCTCTGGCCAGCTCAACTGG - Intergenic
1132448673 15:101952909-101952931 CAGGCTCTGGGCTGTGTTACTGG + Intergenic
1133380602 16:5327223-5327245 CAGGGTCTGGCCAGTTTCACAGG - Intergenic
1134102389 16:11461256-11461278 CTGTCTGTGGCCTGTTGTGCAGG - Intronic
1136574770 16:31116997-31117019 CTGGCTCTGCCCTGTTAAAGTGG + Intronic
1137251080 16:46741399-46741421 ATGGCTCTGGGCTGTTTTATGGG - Intronic
1137888548 16:52132937-52132959 CTTGCTCTGGGCTGTTATACAGG - Intergenic
1138074515 16:54027700-54027722 CTGCCTCTGGCCTGAGTAACTGG + Intronic
1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG + Intronic
1139601390 16:67989579-67989601 CTGGTTCTGGCCTGGATTTCAGG + Intronic
1139810929 16:69616421-69616443 CTGGCTCTGGCATTTTATCCTGG + Intronic
1141983753 16:87566153-87566175 CTGGCTCTGCCCTCTGTGACTGG + Intergenic
1203137436 16_KI270728v1_random:1737484-1737506 CTGGTTCTGGCCAGTTTTAGAGG + Intergenic
1142801895 17:2351518-2351540 CTGGCCCTGGCCTGGTTCCCTGG + Intronic
1146827434 17:36035209-36035231 CTGGCTCTTGCTTTTTTCACGGG + Intergenic
1148132541 17:45270743-45270765 CTGGCTCTGGCCTGTTTTACTGG - Intronic
1151940218 17:77287369-77287391 CTGGCATTGGCCTGCTCTACTGG + Intronic
1152865168 17:82718026-82718048 CTGGCCCTGACCTGTTCTGCGGG + Intronic
1154346019 18:13544210-13544232 CTGCCTCCGGGCTGTTTTCCTGG + Intronic
1154355695 18:13621943-13621965 CTGTCCCAAGCCTGTTTTACAGG + Intronic
1155104114 18:22643598-22643620 CTGGGTCCTGCCTATTTTACAGG - Intergenic
1155575003 18:27234819-27234841 CTTGCTTTGGTTTGTTTTACAGG - Intergenic
1156538637 18:37888165-37888187 CTGGCTCTGGACTGCTTAGCAGG + Intergenic
1157169917 18:45393721-45393743 ATAGCTCTGGCCTGCTTTGCAGG + Intronic
1157284013 18:46364870-46364892 CTGACTCTGGCCAGCTTTACTGG + Intronic
1157452205 18:47797250-47797272 AAGGCTCTGTCCTGCTTTACTGG + Intergenic
1157619684 18:49009074-49009096 CTGCCTCTGGCCTCTTTGACAGG - Intergenic
1157682726 18:49619563-49619585 CTGGCACTGGCCTGCTTCACAGG - Intergenic
1159186226 18:64978247-64978269 CTGGCTCTGGACTGTCTTCCTGG - Intergenic
1160218156 18:76952463-76952485 CTGCCTCTGGCCTGTGCTTCTGG + Intronic
1160636589 19:79644-79666 CAGGCTCTGGGCTGTGTTACTGG - Intergenic
1162338207 19:10074653-10074675 GTGGCTCAGGCCTGTTGTCCTGG + Intergenic
1162588475 19:11576075-11576097 CTGGCTTTGGAGTGTTTTCCTGG + Intronic
1162775817 19:12978428-12978450 GTGGCTCAGGCCTGTTGTCCTGG + Intergenic
1164650193 19:29885855-29885877 CAGGCCCTGGCCTGTGTTGCAGG + Intergenic
1165362671 19:35346376-35346398 CTGGCTCTGGCCAGCTCTGCCGG - Intronic
1166216630 19:41339930-41339952 CTGTCTCTGGGCTTTGTTACCGG - Intronic
1167949169 19:53012635-53012657 TTGGCTCTGGCCGGTTGTCCTGG - Intergenic
1168474345 19:56665087-56665109 CTGGCTCTGGACAGCTTTCCTGG + Exonic
925237992 2:2296115-2296137 CTGGCTCTGGCTTGGTTTATAGG - Intronic
928607359 2:32954936-32954958 ATGCCTCTGGCCATTTTTACTGG + Intronic
929971357 2:46579995-46580017 CCATCTCTGGCCTGCTTTACTGG + Intronic
930372239 2:50516540-50516562 CTGTCTCAGGCTTGTTTTGCTGG + Intronic
931234775 2:60403971-60403993 CTGTTCCTGGCCTGTTTTATTGG + Intergenic
933957263 2:87381513-87381535 CTGGTTCTGGCCAGTTTTGGAGG + Intergenic
934241381 2:90273405-90273427 CTGGTTCTGGCCAGTTTTGGAGG + Intergenic
934271793 2:91543281-91543303 CTGGTTCTGGCCAGTTTTGGAGG - Intergenic
935611712 2:105032511-105032533 CTTGCTCTGCCCTGCATTACAGG - Intergenic
936147782 2:109992892-109992914 CTGGTTCTGGCCAGTTTTAGAGG - Intergenic
936196909 2:110378555-110378577 CTGGTTCTGGCCAGTTTTAGAGG + Intergenic
936271439 2:111052417-111052439 CTGGCTTTCTCCTGTCTTACAGG - Intronic
936564893 2:113575397-113575419 CAGGCTCTGGGCTGTGTCACTGG + Intergenic
938095677 2:128460763-128460785 GTGGCTCAGGCCTGTTGTCCTGG + Intergenic
940124826 2:150311456-150311478 CTGGCTTCAGCCTGTTTTCCAGG - Intergenic
940281409 2:151993500-151993522 CTGGCACTATCCTGTTTTTCTGG - Intronic
940488096 2:154322395-154322417 CTGACTCTGGCCTTTTAAACTGG + Intronic
940686487 2:156857346-156857368 CTGGCCCTGGCTTGCTTTATTGG - Intergenic
941085716 2:161115216-161115238 CTGGCTCTGCCCTCATTTTCGGG + Intergenic
941582134 2:167311886-167311908 CTGCCTCTTTCCTGTTTTTCTGG - Intergenic
942660540 2:178259738-178259760 CTGCCTCTGGCTTCTTTGACAGG + Intronic
946332262 2:219017138-219017160 CTGGCTCTGGGCTGGTCTTCAGG - Intronic
947591200 2:231387005-231387027 ATGGCTTTGGCCTCCTTTACTGG - Intergenic
1168995503 20:2129888-2129910 CTGCCTCTCTCCAGTTTTACTGG - Intronic
1169003185 20:2183210-2183232 CTGCCTCTGGCCTCTTATATTGG + Intergenic
1172240719 20:33410976-33410998 CTGGCTCTGGCCCGTGTGTCAGG - Intronic
1172965292 20:38829956-38829978 ATGCCTCTGGCCCCTTTTACTGG + Intronic
1177708338 21:24738248-24738270 GTGGCTCTGGCCGGTTGTGCTGG + Intergenic
1178485697 21:33019026-33019048 CCAGCTCTGGCCAGTTTTTCAGG + Intergenic
1178738215 21:35171848-35171870 CTGCCTCTGGCCTGTGGCACTGG - Intronic
1180552251 22:16550036-16550058 CTGGTTCTGGCCAGTTTTAGAGG + Intergenic
1180883577 22:19223957-19223979 CTTGATCTGCCCTGTCTTACAGG + Exonic
1181351780 22:22264023-22264045 CTGGTTCTGGCCAGTTTTAGAGG - Intergenic
1182782629 22:32880410-32880432 CTGGCCTTGGCCTGGTCTACAGG + Intronic
1185122959 22:48984058-48984080 CTGCTTCTGGCCTTTTTTGCTGG - Intergenic
949307462 3:2658770-2658792 CTTGCCCAGGCCTGATTTACTGG + Intronic
950121639 3:10485758-10485780 CTGGCTCAGGCCTGCCTTCCCGG + Intronic
950333584 3:12176357-12176379 CTGGCTCTGGAGAATTTTACAGG - Intronic
952821281 3:37488193-37488215 GTGGCTCAGGCCTGTTGTCCTGG - Intronic
954335451 3:49914045-49914067 CTGGCTGTGGCATGTGCTACTGG - Intronic
956036448 3:65097727-65097749 TTGCCTGTGGGCTGTTTTACTGG - Intergenic
956431890 3:69195141-69195163 TTGATTCTGTCCTGTTTTACAGG - Exonic
957311149 3:78520437-78520459 CTGTCTCAGGCCTCTTTTATAGG - Intergenic
962158304 3:132972640-132972662 CTGGCTCCAGCCTATTTTTCTGG + Intergenic
964378755 3:156074939-156074961 CTGGCCCTGGACTTTTTAACTGG - Intronic
964590309 3:158354860-158354882 CTGGCTTTGGCCTGTTCAGCTGG - Exonic
966562871 3:181342909-181342931 GTGGCTCAGGCCTGTTGTCCTGG + Intergenic
967263596 3:187670221-187670243 CTGGCCCTGGGCTGTGTCACCGG - Exonic
970421232 4:15907172-15907194 CTGCCTCTGGACTGTTCTCCTGG + Intergenic
972353556 4:38259857-38259879 CTGGCTCTGTCCTGTGTCACAGG + Intergenic
973278526 4:48335353-48335375 CTGGCTCTCGTCTGTTTCCCAGG + Intergenic
976661202 4:87542525-87542547 CTGGCTCTGTCCTGTGTCATAGG + Intergenic
977816237 4:101416841-101416863 CTGGCTCTGGTCTGCTGAACTGG + Intronic
978542820 4:109837164-109837186 CTGGCTATGGCTGCTTTTACAGG - Intronic
982485800 4:155964455-155964477 CTGGCCCTGGCCTGCCTTTCAGG + Intergenic
984168076 4:176326725-176326747 TTGGCTCTTGTCTGTTTTCCTGG + Intronic
984899907 4:184576824-184576846 GTGGCTCAGGCCTGTAATACCGG - Intergenic
985156734 4:186997255-186997277 CTGGCTCAGGTCTTCTTTACTGG - Intergenic
986759033 5:10863240-10863262 GTGGCTCAGGCCTGTATTCCAGG - Intergenic
988116454 5:26898483-26898505 CTGGCTCTGTTCTGTTCCACTGG - Intronic
993553422 5:89304728-89304750 TTTGCTCTGGCATGTTTTCCAGG + Intergenic
994102147 5:95905091-95905113 CAGGCACTGGCATGTTTTAAAGG + Intronic
996676065 5:126175991-126176013 CTTTCTCTTGCCTGTTTTCCTGG - Intergenic
996723185 5:126649657-126649679 TTGGCTCTGGTCTATTTTAGTGG - Intergenic
1002064775 5:176646708-176646730 CTGCCTCTGTCCTGTCTTACAGG + Intergenic
1002146658 5:177188760-177188782 GTGGCTCAGGCCTGTTGTCCTGG - Intronic
1005581097 6:27235892-27235914 CTGGCTCAGGCCTGTAATCCCGG - Intergenic
1007400334 6:41599336-41599358 CTGGCTCTGGCCGTGTTTTCTGG + Exonic
1007585457 6:42986307-42986329 TTGGCTCTGGCCTGGTGTTCTGG + Intronic
1007772301 6:44201526-44201548 CTCGCTCTGTCATGTTTCACTGG - Intergenic
1007801653 6:44399241-44399263 CTGTGACTGGCCTGTCTTACTGG + Intronic
1008942505 6:57062197-57062219 CTGGCTCATGCCTGTTATCCTGG - Intergenic
1010917356 6:81636597-81636619 CTCGTGGTGGCCTGTTTTACAGG - Intronic
1013371115 6:109471833-109471855 CTGGCACTGGTCAGGTTTACAGG - Intronic
1014250756 6:119113341-119113363 CTGGCTGTGTCCTGAGTTACGGG + Intronic
1015803260 6:137082099-137082121 CTGGCAGTGGCCTGTCTTCCAGG + Intergenic
1017093960 6:150787653-150787675 CTGGCTCTGGACTGTTCCACAGG + Intronic
1018728194 6:166629209-166629231 CTGTCTCCGGCCAGTATTACTGG - Intronic
1019600223 7:1879203-1879225 GTGGCTCATGCCTGTATTACAGG + Intronic
1020230669 7:6316042-6316064 CTGGGTCTGGCTTCTTATACTGG - Intergenic
1022948490 7:35313058-35313080 CTGGGTTTGGCCTGTTGAACTGG + Intergenic
1023020003 7:36003297-36003319 CTGGCTTTGGCCAGTTCTTCAGG + Intergenic
1024247148 7:47479308-47479330 CTGGCTGAAGCCTGTTTTCCTGG - Intronic
1024981156 7:55158786-55158808 CTGGCTCTGCCCTGGTGTCCTGG + Intronic
1028974644 7:96898311-96898333 CTGGCTGTGGTGTGTTTTACTGG + Intergenic
1029587615 7:101485551-101485573 CTTGTTCTGGCCTCTGTTACAGG + Intronic
1032354958 7:131202509-131202531 GTGGCTCAGGCCTGTTGTCCTGG - Intronic
1033153708 7:138938120-138938142 CTCTCTCTGGCCTTTTTTAGAGG - Intronic
1034503598 7:151467987-151468009 GTGGCTCAGGCCTGTTGTCCTGG - Intronic
1039936793 8:42052233-42052255 CTGGCTTTGGCCTTTTGTACCGG - Intergenic
1046518673 8:115296602-115296624 CTTGCTCTGGCTTTTTTGACTGG - Intergenic
1048431457 8:134375496-134375518 CAAGATCTGGCCTGTTTTCCAGG + Intergenic
1049270849 8:141695415-141695437 CTGGCTCCTGCATCTTTTACAGG - Intergenic
1049887531 9:37817-37839 CAGGCTCTGGGCTGTGTTACTGG - Intergenic
1056481296 9:87009096-87009118 GTGGCTCAGGCCTGTTTTCCTGG + Intergenic
1056943631 9:90975849-90975871 CTGGCCCTGGCCTGTCTGATGGG - Intergenic
1057291920 9:93812340-93812362 CCGGCTCTGGCTTGTGTCACAGG - Intergenic
1057519081 9:95746667-95746689 CTGGCTCTCACATATTTTACTGG + Intergenic
1057835777 9:98443933-98443955 CTGGCCCTGGTCTGGCTTACTGG + Intronic
1060199582 9:121644936-121644958 CTGGCACTGGCCTGGGTTCCAGG - Intronic
1060887874 9:127168329-127168351 CTGGCTCTGGTCTGTTTTGGAGG + Intronic
1061231350 9:129317731-129317753 CCGGCTCTGGCCTGTGCAACGGG + Intergenic
1061328000 9:129875630-129875652 CAGGCTCTCACCTGTTGTACAGG - Exonic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1062578443 9:137219186-137219208 TTGGCGCTGGCCTGTGTTGCAGG + Intergenic
1186358577 X:8813787-8813809 CAGGCTCTGTCCTGTTTTGGGGG + Intergenic
1187120663 X:16403271-16403293 CTGGCTCTGTCCTGTTTCGAAGG - Intergenic
1195139870 X:101948567-101948589 CTGGCTCTGCCCTATCTTTCAGG + Intergenic
1197769749 X:130082502-130082524 CTGGCTCAGGCCCCTTTTCCAGG + Intronic
1199453658 X:148002350-148002372 CTGGCACTTGCCTGTACTACTGG + Intronic
1201950222 Y:19555314-19555336 CTGGCTCTCGCCTTTCTTTCTGG + Intergenic