ID: 1148136315

View in Genome Browser
Species Human (GRCh38)
Location 17:45294160-45294182
Sequence ACTCTTATGCAGAGAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148136315_1148136318 -5 Left 1148136315 17:45294160-45294182 CCCTCTACTCTCTGCATAAGAGT 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1148136318 17:45294178-45294200 AGAGTTGAGGACACGAGCAGTGG 0: 1
1: 0
2: 2
3: 20
4: 258
1148136315_1148136319 15 Left 1148136315 17:45294160-45294182 CCCTCTACTCTCTGCATAAGAGT 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1148136319 17:45294198-45294220 TGGCAACAGCCAAACCCACATGG 0: 1
1: 0
2: 1
3: 19
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148136315 Original CRISPR ACTCTTATGCAGAGAGTAGA GGG (reversed) Intronic
902814894 1:18910631-18910653 ACCCATGTGCAGAGAGCAGAGGG - Intronic
906660293 1:47577202-47577224 ACACTTAAGCCGAGAGTTGAAGG + Intergenic
907861514 1:58358155-58358177 ACCTTTATGCAGATGGTAGAGGG + Intronic
908138456 1:61157316-61157338 TCTCTTTTGCAGGGAGTGGAGGG - Intronic
909984311 1:82141859-82141881 ATTCTTATTCAGAGGGTAGTGGG + Intergenic
910445493 1:87295572-87295594 ACTCTAGTTCAGAGAGCAGAGGG + Intergenic
911860878 1:102946737-102946759 ACACATATGCAGAGAGAATACGG + Intronic
912642491 1:111360774-111360796 AATCATATGCAGAGGGGAGATGG - Intergenic
912836110 1:112997910-112997932 TCTCTTATGCAGTGAGGAAAGGG + Intergenic
916522797 1:165580354-165580376 ACTCTGATGCAGATGGTACATGG - Intergenic
917172019 1:172187152-172187174 ACTCTCATGCAAAGAAAAGAGGG - Intronic
917503724 1:175609483-175609505 AGTCTGTTGCAGAGACTAGAGGG + Intronic
918269390 1:182882530-182882552 GCTCTTATTCTCAGAGTAGATGG + Intronic
918578902 1:186101038-186101060 CCTCTTTAGCAGAGAGTAGATGG - Intronic
918663119 1:187114211-187114233 ACTCATAGGCACAGAGTAGGAGG + Intergenic
920015558 1:202904962-202904984 ACTCTTCTGCATACAGCAGAAGG - Intronic
920207751 1:204305246-204305268 ACTCTGATGCAGAAAGTATGGGG + Intronic
921134179 1:212245357-212245379 ACACTTCTGCAGACAGTACAAGG - Intergenic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921502718 1:215925635-215925657 TCCCTTATTCAGAGGGTAGAAGG - Intronic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
1067582754 10:47455927-47455949 ACTCTTGCTCAGAGAGCAGATGG - Intergenic
1067932943 10:50581708-50581730 ACACCTATTCAGAGAGTAAAGGG - Intronic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1071126199 10:82338098-82338120 ACTTTTTTCCAGAGAGGAGAGGG - Intronic
1071263722 10:83945228-83945250 ACTCCTATGCAGTGAATAGTTGG - Intergenic
1071685028 10:87745407-87745429 AGTCTTCTGCATATAGTAGATGG + Intronic
1071706697 10:88006934-88006956 GCTGTTAGGGAGAGAGTAGATGG + Intergenic
1072308543 10:94131851-94131873 GCTCTTCTGCAGAGAGATGAAGG - Intronic
1074230222 10:111526322-111526344 ATTCTGATGCAGAGGGTAGAAGG + Intergenic
1074846971 10:117406962-117406984 ACTCTTAGGGAGAGAGGAGGAGG + Intergenic
1075010830 10:118868893-118868915 AGTGTGAAGCAGAGAGTAGATGG - Intergenic
1075180004 10:120202498-120202520 AGTCTTTTGAAGACAGTAGATGG + Intergenic
1075332381 10:121583141-121583163 ACTTTTCTGCAGAGATTAGGAGG - Intronic
1079538933 11:21548687-21548709 AACCTTATGCAAAGACTAGATGG - Intronic
1079670528 11:23164845-23164867 ACTCTTATGAAGGTAGAAGAGGG + Intergenic
1080814442 11:35740381-35740403 ACTCTTGTGCTTAGAGGAGAAGG + Intronic
1081895505 11:46582306-46582328 ATACTTAAGCAGAGACTAGAAGG - Intronic
1085400372 11:76232425-76232447 GCTGTGATGCAGAGAGGAGAGGG - Intergenic
1087246241 11:95841038-95841060 AATCTTTTGGAAAGAGTAGAGGG - Intronic
1089069904 11:115691533-115691555 ACTCAGAAGCACAGAGTAGAAGG + Intergenic
1089499395 11:118923613-118923635 ACTCTTGTGCCTGGAGTAGAAGG - Intronic
1090096304 11:123744627-123744649 AATGTTATGCAGAAAGCAGAAGG - Intergenic
1091991062 12:4956178-4956200 AATCTCAGGCAGAGAGCAGAGGG + Intergenic
1092800161 12:12156860-12156882 ACTCTGATGGAGAGAAAAGAAGG - Intronic
1095273962 12:40256994-40257016 ATTTTTATTCATAGAGTAGATGG - Intronic
1099564972 12:84231047-84231069 TCTCACATGAAGAGAGTAGAGGG - Intergenic
1099599447 12:84714153-84714175 ACTCATGGGCAAAGAGTAGAAGG + Intergenic
1100572353 12:95854699-95854721 ACCCTTATGCATAGGGGAGAGGG - Intergenic
1101835862 12:108295071-108295093 ACTGGAATGCAGAGAGAAGATGG + Intronic
1105390306 13:19970924-19970946 ACATTTAAGCAGAGAATAGACGG + Intronic
1106689074 13:32094543-32094565 ACTCATAGACACAGAGTAGAAGG - Intronic
1108687004 13:52828332-52828354 ACTCTTAGGAAGAGAGTACAAGG - Intergenic
1110791066 13:79587321-79587343 ACTCTTATGGAAAGATTTGAGGG + Intergenic
1111760937 13:92463075-92463097 GCTTTTATTCAGAGAATAGAGGG + Intronic
1112452814 13:99527191-99527213 ACTAATATTCAGAGGGTAGAGGG + Intronic
1112520565 13:100091086-100091108 GCTCTGATGCAGAGAGTAGATGG + Intronic
1112523035 13:100115231-100115253 ACTCATAGAGAGAGAGTAGAAGG + Intronic
1112667752 13:101596240-101596262 ACTCTTAGAAATAGAGTAGAAGG + Intronic
1114443414 14:22769232-22769254 AATCATGGGCAGAGAGTAGAAGG - Intronic
1114469502 14:22949689-22949711 AAGCTTATACAGAGAGTATAAGG + Intronic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1117621473 14:57591438-57591460 TGGCTTATGCAGAGAGTAGAAGG + Intronic
1119895229 14:78214297-78214319 ACTCTTGTGCAGAGATATGAAGG - Intergenic
1120824134 14:88940002-88940024 ACTATTAGGCAGAGGGTAGAGGG - Intergenic
1120994890 14:90409587-90409609 ACTCCTTGGCAGAGAGTTGAGGG - Intergenic
1121936535 14:98024584-98024606 AGTCTTATGCATACAGTAAATGG + Intergenic
1125278376 15:38017681-38017703 ACTCAGATGCAGTGAGTAGGTGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125581016 15:40785793-40785815 ACTCTTATTCAAGGGGTAGAAGG + Intronic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1126969913 15:54099189-54099211 ACTCTTAGGCACAGAGAAGCTGG - Intronic
1129090929 15:73149588-73149610 ATTCTTGTGCAGAAAGTAGAAGG + Intronic
1131532158 15:93203031-93203053 CCTCTTGGGCAGAGAGAAGAAGG - Intergenic
1133598565 16:7317064-7317086 GCTTTTCTGCAGAGAATAGAGGG + Intronic
1134796673 16:17044994-17045016 ACTCAGAAGCAAAGAGTAGAAGG - Intergenic
1137226797 16:46520500-46520522 ACTTTTGGGCATAGAGTAGAAGG - Intergenic
1140556824 16:75930903-75930925 AATATTAAGCAGAGAGTAGAAGG - Intergenic
1141339771 16:83192326-83192348 TCACTTCTGCAGAGAGCAGAGGG + Intronic
1143123844 17:4628072-4628094 GCTCTGATGCAGAGTGTAGGAGG + Intergenic
1143426299 17:6841810-6841832 GCTCTGATGCAGAGTGTAGGAGG - Intergenic
1146958432 17:36951053-36951075 ACTCTTTTGCAGGGAAGAGAAGG - Intronic
1148136315 17:45294160-45294182 ACTCTTATGCAGAGAGTAGAGGG - Intronic
1148519371 17:48255942-48255964 AGTGTTAAGCAGAGAGCAGACGG - Intronic
1149359608 17:55880380-55880402 ACTCATAGACAAAGAGTAGAAGG + Intergenic
1150676982 17:67252665-67252687 AAATTTATACAGAGAGTAGAAGG + Intergenic
1151581134 17:74979639-74979661 GCTGTTCTGCAGAGAGTAGGTGG - Intergenic
1203164484 17_GL000205v2_random:81165-81187 ACTCTCATGCATAGAGTATAGGG - Intergenic
1155550527 18:26960186-26960208 AGTCTTCTGCAGAGAGATGATGG + Intronic
1155712901 18:28904852-28904874 ACTCTAAGGCAAAGAGCAGAAGG + Intergenic
1155930890 18:31707059-31707081 CCTCTTATGAAGAGAGAAAAAGG - Intergenic
1156362579 18:36397286-36397308 TCTGTTCAGCAGAGAGTAGAGGG - Intronic
1156724340 18:40109988-40110010 ACTTTCATAAAGAGAGTAGATGG + Intergenic
1159667106 18:71174981-71175003 ACTCCTATGCAGAGGATAGTGGG - Intergenic
1159941708 18:74413365-74413387 ATGCCTATGCAGAGAGAAGATGG - Intergenic
1162994925 19:14328539-14328561 ACTCTTGAGCAAAGAGTTGAAGG + Intergenic
1163022888 19:14492983-14493005 AGTCTGAGGCAGAGTGTAGATGG - Intronic
1165782867 19:38444007-38444029 ACTGTTAGGCAGAGAGTTGGTGG + Intronic
1166884998 19:45954719-45954741 ACTCTCATGCAGAAATGAGAAGG - Intronic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
926643339 2:15261594-15261616 ACTCTTCAGCAAAGTGTAGATGG + Intronic
927034506 2:19159617-19159639 ACAGGTATGCAGAGAGTAAATGG - Intergenic
927249539 2:20985248-20985270 TCTGCTATGCACAGAGTAGAAGG + Intergenic
927730501 2:25467048-25467070 ACACTTATTCAGAGAGGAGCTGG - Intronic
928848963 2:35718550-35718572 ACTCTTAAGCATAGAGCAAATGG + Intergenic
929914231 2:46120655-46120677 ACTCTTCTGAAGATAGGAGAAGG + Intronic
930113606 2:47699884-47699906 ACTTTTATGGAGATAGTAGATGG + Intronic
936245651 2:110824943-110824965 ACTCTTCTGAAGAAAGTTGATGG + Intronic
937304188 2:120861110-120861132 ACTCTCTTGCAGAGGGTAAATGG - Intronic
941348571 2:164402481-164402503 ACTCATGGACAGAGAGTAGAAGG + Intergenic
1169886432 20:10403600-10403622 AATTTTATGCTGTGAGTAGAAGG - Exonic
1169945753 20:10986168-10986190 ACTCTTGGGGAGAGAGTTGATGG + Intergenic
1173088296 20:39945896-39945918 ACTGTTATACACATAGTAGAGGG - Intergenic
1173811593 20:45959267-45959289 AATCTGCTGCAGAGAGAAGAAGG + Exonic
1174095741 20:48088173-48088195 ACTCAAATGCTGAGAGTAGTGGG + Intergenic
1183825906 22:40387236-40387258 ACTCTGTGGCAGTGAGTAGACGG - Intronic
949239913 3:1858807-1858829 TCTATTAAGCAGAGAGGAGAGGG + Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
953162750 3:40436620-40436642 ACTCATCAGCAAAGAGTAGAAGG - Intergenic
959054688 3:101555569-101555591 ACTCTCAGGCAGATAGGAGAGGG + Intergenic
960334271 3:116397032-116397054 GCTCTTATGTTGAGAATAGAAGG - Intronic
960419808 3:117430022-117430044 ATTCTTAAGCATACAGTAGAAGG + Intergenic
960735392 3:120773683-120773705 ACTCTTACTCAGAGATGAGAGGG - Intronic
962389788 3:134961587-134961609 ATTCTCTTGCAGAGAGTCGATGG + Intronic
968981213 4:3850639-3850661 ACTCTCCTGCAGAGAGGAGTTGG - Intergenic
969686061 4:8674923-8674945 CCTGTTTTGCAGAGAGAAGAGGG - Intergenic
970167076 4:13250106-13250128 ACTGCAATGCAGAGAGTAAATGG + Intergenic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
970904029 4:21194333-21194355 ATTTTTATGCAGAGACTAGTAGG - Intronic
972428914 4:38961486-38961508 ATTCTTCTGCAAATAGTAGAAGG - Intergenic
977523161 4:98111281-98111303 ACTCTTAGGTAGCGAGTAGGGGG + Intronic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
982781720 4:159498339-159498361 ACACTTATGCAGCTGGTAGATGG + Intergenic
984293156 4:177820942-177820964 ATTCTTATGGAGACAGTAAAAGG - Intronic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
986494019 5:8323481-8323503 ACTCTTACACAAAGAGGAGAGGG - Intergenic
989342723 5:40394187-40394209 CGTCTTATGCAGAGAGCTGAAGG + Intergenic
989577430 5:43001156-43001178 TGTCTTATGCAGAGATTGGAGGG + Intergenic
989581216 5:43034782-43034804 TGTCTTATGCAGAGATTGGAGGG + Intergenic
989971599 5:50531820-50531842 ACCATTATGCAGTGTGTAGAGGG + Intergenic
990846097 5:60141438-60141460 ATACTGAGGCAGAGAGTAGAAGG + Intronic
992090821 5:73314762-73314784 TCTATTATGAAGAGAGTAAAGGG + Intergenic
992910228 5:81389236-81389258 ACTGCAATGCAGAGAGTAGGAGG + Intronic
993554188 5:89315240-89315262 ACTTTTATGCAGACATTACAGGG - Intergenic
994192026 5:96879303-96879325 ATTCTTGTGCAGCGAGCAGAAGG - Intronic
996603868 5:125297771-125297793 AGCCTGATCCAGAGAGTAGATGG + Intergenic
997050105 5:130370365-130370387 ACTCTTAGGCAGTGACTACAAGG - Intergenic
997259691 5:132456377-132456399 ACTATAATGCAGATAATAGAGGG + Intronic
998695988 5:144640199-144640221 ACTTTTAAGCAGAGATTTGAAGG + Intergenic
1000384502 5:160661525-160661547 AATAATTTGCAGAGAGTAGAGGG + Intronic
1000455814 5:161447527-161447549 ACTCTTATGGACAGAATAAAAGG - Intronic
1001132482 5:169076049-169076071 ACTCTCATACAGAGAACAGAGGG - Intronic
1002548250 5:179967165-179967187 ACTCTTAGGGTGAGAGAAGAAGG - Intronic
1003025483 6:2551320-2551342 TCTATTATGTAGAGAGGAGAAGG - Intergenic
1003743307 6:8968397-8968419 ACTTTTATTTAGAGAGCAGATGG + Intergenic
1008977316 6:57442962-57442984 ACTCAGAAGCAGAGAATAGAAGG - Intronic
1009165452 6:60335913-60335935 ACTCAGAAGCAGAGAATAGAAGG - Intergenic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1011030622 6:82918995-82919017 CCTCCTGTGCAGAGAGTAGCAGG + Intronic
1011154426 6:84314159-84314181 AATCCTATCCAGAGAGGAGATGG - Intergenic
1011502561 6:88007052-88007074 ACTCTTGAGCACAGAGGAGAGGG - Intergenic
1012749701 6:103141881-103141903 ACACTTATTTAGAGAGTATATGG - Intergenic
1012912611 6:105135863-105135885 ATTCTTATACAGAGAATAGGTGG + Intronic
1013271354 6:108548488-108548510 ACTTTTAGGGAGAGAGAAGAGGG + Intergenic
1014418959 6:121217360-121217382 AATCTTATCCAGAGAGAACATGG + Intronic
1014427530 6:121326927-121326949 ACTCTTACCTAAAGAGTAGAAGG - Intronic
1021326422 7:19274786-19274808 ATTCTTACGAAGAGTGTAGAAGG + Intergenic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1023283472 7:38594902-38594924 AATCTAAGGCAGAGATTAGATGG + Intronic
1023949432 7:44830586-44830608 GCACTTAAGCAGAGAGAAGAAGG - Intronic
1024415637 7:49102800-49102822 ATTCTCAAGCAGAAAGTAGAGGG - Intergenic
1024622126 7:51169660-51169682 ACTCATTGACAGAGAGTAGAAGG + Intronic
1027626584 7:80552525-80552547 AGTCATATGCAGAGAATTGAAGG - Intronic
1033652038 7:143351088-143351110 TTTCTTATGCAGAGATTGGAGGG + Intronic
1040632750 8:49235069-49235091 ACTCATGGGCATAGAGTAGAAGG - Intergenic
1041347880 8:56920429-56920451 TCACTTATGCTGAGAGAAGACGG + Intergenic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1046031087 8:108784877-108784899 ACTGTTTTGCAGAGAGGAGGAGG + Exonic
1047238098 8:123060291-123060313 CCTCTTATTTGGAGAGTAGATGG - Intronic
1047773875 8:128052893-128052915 TCTCCTATGAAGACAGTAGATGG + Intergenic
1048885612 8:138907023-138907045 GCTCTTATCCACAGAGTAGCCGG - Intronic
1051723560 9:20065222-20065244 ACTCTTACGCAGAGAGGAAGTGG - Intergenic
1052780513 9:32777891-32777913 ACACTTATCAATAGAGTAGAAGG - Intergenic
1053434050 9:38063524-38063546 ACTCTTGAGCTGAGTGTAGAAGG - Intronic
1056421815 9:86435539-86435561 ACTCTTATGAAGAAAGAAAAAGG + Intergenic
1057706520 9:97398877-97398899 ACTTTTATGCTGTGAGCAGAAGG - Intergenic
1058041365 9:100305363-100305385 ACTCTTATGCAGAGCCCAGCTGG + Intronic
1058268643 9:102940808-102940830 ACTCTGATACTGAGAATAGATGG + Intergenic
1062323185 9:136000535-136000557 ACTCGTGTGCAGAGACTACACGG - Intergenic
1187679324 X:21750790-21750812 ACTCTGGTGCACAGAGGAGATGG + Intronic
1188628343 X:32315878-32315900 ACTCTTGTACAGAGAGTAAAAGG - Intronic
1190591167 X:52003029-52003051 ACTCATAGGAAAAGAGTAGAAGG - Intergenic
1191166086 X:57393560-57393582 AATCTCATGCAGAGATTGGAGGG - Intronic
1191875072 X:65787772-65787794 ACTCCCATGCAGAGTGAAGATGG + Intergenic
1197113371 X:122802310-122802332 ACTCATAAGCAGAGAATAGAAGG + Intergenic
1197370245 X:125617565-125617587 ACCTTTGGGCAGAGAGTAGAGGG + Intergenic
1197777899 X:130131796-130131818 ACTCCTAAGAAGAGAGAAGAGGG + Exonic
1198755019 X:139973658-139973680 ACTCTTCTGCAGAGACCACAGGG + Intergenic