ID: 1148137113

View in Genome Browser
Species Human (GRCh38)
Location 17:45300645-45300667
Sequence CTGTGGGCAGGCAGAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 458}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148137113_1148137120 11 Left 1148137113 17:45300645-45300667 CCTCCTTTTCTGCCTGCCCACAG 0: 1
1: 0
2: 3
3: 43
4: 458
Right 1148137120 17:45300679-45300701 CTCTATCCTCATCCTCCTCCTGG 0: 1
1: 0
2: 7
3: 57
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148137113 Original CRISPR CTGTGGGCAGGCAGAAAAGG AGG (reversed) Intronic
900609498 1:3538510-3538532 CTGGGGCCAGGCAGAAACAGGGG + Intronic
900763999 1:4491750-4491772 CTGTGTGCAGGAAGAAGAGCAGG + Intergenic
901024794 1:6273521-6273543 CTGTGGGCTGGCAGCAAGGTGGG + Intronic
901123550 1:6913511-6913533 CTGGGGGCAGGGGGAAAGGGAGG - Intronic
901422421 1:9160201-9160223 CTATGAGCAGGGAGAAGAGGGGG - Intergenic
901705320 1:11068886-11068908 CTGTGGGCAGTCTGAAAACCAGG + Intronic
902239419 1:15078557-15078579 CTGGAGGGAGGCAGACAAGGCGG + Intronic
902370926 1:16006328-16006350 CTGTGGGCAGGCCGATTAGCTGG + Exonic
902545934 1:17190415-17190437 CGGTGGGCAGGCATGAAAGCCGG + Intergenic
902971470 1:20055463-20055485 CAGTGGGCAGTAAGAAAAGCTGG - Intronic
903153635 1:21430015-21430037 TTGGGGGCAGCCAGAAGAGGAGG - Intergenic
903423918 1:23238902-23238924 CTGAGGGCAGGCAGCAGAGACGG - Intergenic
903769529 1:25755072-25755094 CTGTGGGCAGCCCCAACAGGAGG + Intronic
903994846 1:27299370-27299392 CTGTGGGCATCAAGAAAAGTTGG + Intronic
904307599 1:29600144-29600166 CTGTGGGAAAGGAGAAAATGGGG + Intergenic
904746901 1:32716841-32716863 AAGTGGGCGGGGAGAAAAGGCGG + Intergenic
904886422 1:33742105-33742127 CTGTGGGCAGGAAGAAGCAGGGG - Intronic
905120630 1:35679246-35679268 CTGTGGAGAGGCAGACCAGGAGG - Intergenic
905234418 1:36536108-36536130 CTGTAGGCAGAAAGAACAGGAGG + Intergenic
905387292 1:37613620-37613642 CCGTGGGCAGGAAGCAGAGGTGG + Intronic
905973051 1:42155468-42155490 CTGTGGCCAGGCAGCAGAAGAGG - Intronic
906822160 1:48940982-48941004 GAGTGGGCAGGCAGAGAAAGGGG + Intronic
907299234 1:53476216-53476238 CAGAGGGCAGGCAGAGAAGGAGG - Intergenic
908392879 1:63699361-63699383 TGGTGGGCAGGCAGTTAAGGTGG - Intergenic
908652926 1:66355879-66355901 AAGTAGGCAGGCAGACAAGGTGG - Intronic
908912182 1:69084835-69084857 CTGTCTTCAGGCAGAAAAGGAGG - Intergenic
909477122 1:76093643-76093665 CTGTCTTCAGGCAGAAAATGGGG - Intronic
910262429 1:85305321-85305343 CTGTGAGCTGGCAGAAAACTTGG + Intergenic
911015753 1:93330275-93330297 CTGTGGGAAGGGAGAAAGAGAGG - Intergenic
914998112 1:152562424-152562446 CTGTGGGCAGCCAGCCAAGATGG + Intronic
915028493 1:152855650-152855672 CTGTGGGCAGGGAGCATATGTGG - Intergenic
915441848 1:155950490-155950512 CAGTGGGCAGGAAGAACAGCAGG + Intronic
915443349 1:155960532-155960554 CTGTGGGCACACAGAAGGGGAGG + Intronic
915583569 1:156830917-156830939 CTGGGGGCTGGTAGAAAAGAAGG - Intronic
915733151 1:158068092-158068114 CAGTGGGAAGGCGGTAAAGGTGG + Intronic
916233574 1:162562891-162562913 GTGGGGGAAGCCAGAAAAGGAGG + Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
918095449 1:181330336-181330358 CTGGAGGCAGGCAGAGAAGAAGG - Intergenic
918320397 1:183358777-183358799 AGGTGGGAAGGCAGAAAAAGAGG - Intronic
918333791 1:183487230-183487252 ATGTGGGCAGTCTGAAAAGCTGG - Intronic
918378558 1:183932900-183932922 CTGTGGACAGACACAGAAGGGGG - Intronic
918991900 1:191707669-191707691 CTGTGTGCAGTCAGAACAGTTGG - Intergenic
919778414 1:201208359-201208381 CTGAGGGCAGGAAGCAAAGTGGG + Exonic
919837632 1:201586618-201586640 CAGTGGGCAGGCACACATGGGGG + Intergenic
919879697 1:201893531-201893553 CTGTGGATGGGGAGAAAAGGAGG - Intergenic
921099941 1:211920143-211920165 GTGTGGGCAGGAAGCAAAGAAGG - Intergenic
921311482 1:213848296-213848318 CTGTGGTCAGGAATAAAGGGAGG - Intergenic
921608679 1:217185035-217185057 GTGTGGGGAGGCATAAAAGAAGG - Intergenic
922249400 1:223834120-223834142 ATGAGGGCAGGGAGAACAGGGGG + Intronic
922281989 1:224134554-224134576 TTTTGGGGAGGTAGAAAAGGAGG + Intronic
922424844 1:225483161-225483183 CTTTGGGAAGCCAGAACAGGAGG + Intergenic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923645696 1:235818403-235818425 GTGTTGGGTGGCAGAAAAGGGGG - Intronic
924189174 1:241531335-241531357 CTTTGGGCAGGAGGAATAGGTGG + Intergenic
1062863419 10:828483-828505 CCGCTGACAGGCAGAAAAGGAGG - Intronic
1063365059 10:5485705-5485727 CAGTGGGCAGGCAGAAGGAGTGG - Intergenic
1063368603 10:5506945-5506967 TTGTGGTCAGAGAGAAAAGGAGG + Intergenic
1064717145 10:18188283-18188305 AGGTGGGCAGGAAGGAAAGGAGG - Intronic
1065253105 10:23836916-23836938 CTGTGGGAAGGAAGGAAGGGAGG + Intronic
1065715865 10:28567657-28567679 CTTATGGCAGGCAGAAGAGGTGG - Intronic
1065818170 10:29500671-29500693 CCTTAGGAAGGCAGAAAAGGTGG - Intronic
1066454848 10:35564317-35564339 CTGTGGGCAGGCGGCAAGGAAGG - Intronic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067332375 10:45334071-45334093 CTGTGGGGAGGCTGACAAGATGG - Intergenic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1070514101 10:77187651-77187673 CAGGGGGCAGGCAGAGAAGCAGG + Intronic
1070969162 10:80549416-80549438 CTGTATGGAGGCAGAACAGGAGG - Intronic
1071199941 10:83209913-83209935 CTGTCTTCAGGCAGAAAAGGGGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071573956 10:86712369-86712391 CTGGAGGGAGGCAGGAAAGGTGG + Intronic
1071711998 10:88059030-88059052 CTGGGGGCAGGGAGAAAAAAGGG + Intergenic
1072945175 10:99803493-99803515 CTGAGGGATGGAAGAAAAGGAGG - Intronic
1073273254 10:102285330-102285352 CTGTGAGCAGGAAGATAAGCTGG - Intronic
1073289166 10:102404929-102404951 CTGTGCGCAGGTAGAAGACGTGG + Exonic
1074049065 10:109866288-109866310 CTGAGGGCAGACAGATAGGGTGG + Intronic
1074925217 10:118061997-118062019 CTTTGGGAAGGCAGAGAAGCAGG + Intergenic
1075611675 10:123859742-123859764 CTGTGGTCAGGGTGAAAAGGAGG - Intronic
1075810569 10:125222005-125222027 CTGTGAGCAGGAGGCAAAGGGGG - Intergenic
1076366025 10:129921594-129921616 CCGTGGGCTGGCTGCAAAGGTGG - Intronic
1076468283 10:130700822-130700844 CAGTAGGCAAGCAGAAAACGTGG + Intergenic
1077014591 11:394004-394026 TTGTGGGATGGGAGAAAAGGAGG + Intronic
1077016044 11:399537-399559 AGGGGGACAGGCAGAAAAGGGGG - Intronic
1077601268 11:3576588-3576610 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
1077663087 11:4086413-4086435 CTTTGGGCTGGCAGGTAAGGAGG - Intronic
1078100381 11:8327089-8327111 CAGTGAGGAGGCAGAAATGGAGG + Intergenic
1078531917 11:12143177-12143199 AGGTTGCCAGGCAGAAAAGGAGG + Intronic
1078613902 11:12847102-12847124 GAATGGGCAGGCAGAAAGGGAGG - Intronic
1078790972 11:14541632-14541654 CTTTTGGAAGGCAGAAAAGCTGG + Intronic
1078815649 11:14819710-14819732 CTGAGGGCAGCTAGAAAAGGTGG + Intronic
1079493715 11:21017179-21017201 ATGTTGGGAGGCAGGAAAGGAGG + Intronic
1079545171 11:21625379-21625401 TTCTGGGCAGGGAGAAAAGTGGG - Intergenic
1080897536 11:36459002-36459024 GTGTGCTCTGGCAGAAAAGGAGG + Intronic
1080956604 11:37104298-37104320 ATGTCGGCAGGTAAAAAAGGAGG - Intergenic
1081856508 11:46307685-46307707 CAGGGGGCAGGCAGGAAAGAGGG - Intronic
1081910596 11:46697459-46697481 GGGTGGGCAGGAAGAAGAGGGGG + Intronic
1083608186 11:63991525-63991547 CTCTGCCCAGGGAGAAAAGGTGG - Intronic
1083983107 11:66190789-66190811 CTGTGGGCAGTCATTGAAGGGGG + Intronic
1084085585 11:66853627-66853649 CTGCGGGGAGGCAGGAAGGGTGG - Intronic
1084257185 11:67951162-67951184 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1087311003 11:96543245-96543267 TTGTTGCCAGGCAGAAAGGGAGG + Intergenic
1087432364 11:98069965-98069987 CTGTGAAAAGGAAGAAAAGGGGG + Intergenic
1088228323 11:107645566-107645588 CTTTGGGAAGCCAGGAAAGGTGG - Intronic
1088817726 11:113433102-113433124 CTGTGGCGAGGAAAAAAAGGAGG + Intronic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1090078675 11:123595753-123595775 CAGTGGGCAGACAGCAAAGTGGG - Intronic
1090178507 11:124673389-124673411 CTGTGAGCAGGGAGAAAGTGCGG - Intronic
1090667050 11:128921350-128921372 GTGTTGGCAGGCAGAGCAGGCGG + Intergenic
1090810298 11:130234086-130234108 TGGTGGGCTGGCAGAAAAAGAGG - Exonic
1092427417 12:8385948-8385970 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1093312663 12:17609429-17609451 TTGTGGGCAGGCAGATAAAAAGG + Intergenic
1093607627 12:21111867-21111889 CTGTAAGCTGGGAGAAAAGGTGG - Intronic
1095620549 12:44248640-44248662 CAGTGGGCAGGCAGCATTGGAGG - Intronic
1096100853 12:48969825-48969847 CTGAGCGGAGGCAGGAAAGGGGG + Intronic
1096616141 12:52834524-52834546 CTGGGGGCAGGGGGAGAAGGTGG - Intergenic
1098026945 12:66213934-66213956 ATTTTGGCAGGCAGTAAAGGAGG + Intronic
1098424126 12:70340341-70340363 CTGAGGTCAAGAAGAAAAGGAGG - Intronic
1099017677 12:77364287-77364309 GTGTTGGAAGGCAGGAAAGGAGG + Intergenic
1101100282 12:101384689-101384711 CTGGGGGCAGGAAGGAAAGGAGG + Intronic
1101513662 12:105414979-105415001 CTGTGGGAAGGAACAAAAAGAGG + Intergenic
1104426633 12:128683241-128683263 CTGTGGCCAGGCAGAAACCTCGG - Intronic
1104649705 12:130522699-130522721 CTGTGCGCAGGGAGAGGAGGAGG + Intronic
1104889234 12:132132420-132132442 CTGTGACTGGGCAGAAAAGGAGG - Intergenic
1106041848 13:26101054-26101076 CTGTGGGAAGGCAGAACATGTGG + Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1107958968 13:45542554-45542576 CTGTGGGCAGAGAGACCAGGGGG - Intronic
1110530546 13:76592439-76592461 TGGTGGGCTGGCAGAAAAAGAGG - Intergenic
1112346658 13:98595821-98595843 CAGTGGTCAGGCAGGAATGGTGG + Intergenic
1112495949 13:99904990-99905012 ATGTGGGGGAGCAGAAAAGGTGG - Intergenic
1113774958 13:112938813-112938835 CTGTGGCCAGGCAGGAGAGCTGG + Intronic
1113960916 13:114125758-114125780 CTGTGTTCACGCAGGAAAGGAGG - Intronic
1114266442 14:21075113-21075135 CTGTGGGCCTACAGAAGAGGGGG + Exonic
1114617734 14:24077131-24077153 CTGAGGGCAAGCAGAGAGGGTGG - Intronic
1117158325 14:52962626-52962648 CTGTCTTTAGGCAGAAAAGGAGG - Intergenic
1117397954 14:55329964-55329986 ATTTGGGAAGACAGAAAAGGAGG - Intronic
1118476214 14:66119929-66119951 CTGTGTACAGGCAGAGAATGAGG + Intergenic
1119425120 14:74530086-74530108 CTCTGGGCAGGCAGAAATACAGG - Intronic
1119485536 14:74984534-74984556 TAGAGGGCAGGCAGAGAAGGAGG - Intergenic
1120018242 14:79498582-79498604 CTGTGGGCATGAGGAAAGGGAGG - Intronic
1120310689 14:82823580-82823602 ATGTGGGCAGGAAGAAAGAGCGG - Intergenic
1121261375 14:92568797-92568819 CTGTGGCCATGCTGAAAGGGTGG + Intronic
1121407857 14:93729716-93729738 CTGCGGGGAGGAAGAAGAGGAGG + Intronic
1121731574 14:96190996-96191018 CTGTGGGTAGGGGCAAAAGGAGG - Intergenic
1121999701 14:98636692-98636714 ATATGGACAGGCAGAGAAGGTGG - Intergenic
1122240188 14:100359494-100359516 CAGTGGGGAGGGAGAAATGGGGG + Intronic
1122417704 14:101558213-101558235 AAGAGGGCAGGCAGAAAGGGAGG + Intergenic
1122498864 14:102180596-102180618 CTGTGGGCAACAAGAAAAGTGGG + Intronic
1122796231 14:104207561-104207583 GGGTGGGCAGGCGGGAAAGGAGG - Intergenic
1123476056 15:20593140-20593162 GTGGGGACAGGGAGAAAAGGGGG + Intergenic
1123641956 15:22407224-22407246 GTGGGGACAGGGAGAAAAGGGGG - Intergenic
1123674100 15:22690976-22690998 CTGTGGGAAGGCAGACGCGGAGG - Intergenic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1124319394 15:28702171-28702193 GTGTGGGCAGGCAGGAAGAGGGG - Intronic
1124326112 15:28763967-28763989 CTGTGGGAAGGCAGACGCGGAGG - Intergenic
1124373969 15:29118937-29118959 CTGTGGGCAGGCCAGAGAGGAGG - Intergenic
1124662371 15:31560772-31560794 CAGTGGGCAGGCTGAACTGGAGG - Intronic
1125519362 15:40339583-40339605 CCGTCGGCAGGCAGAGCAGGGGG - Exonic
1127221794 15:56887595-56887617 GTGTGGGGAGGAAGGAAAGGTGG + Intronic
1127263989 15:57346651-57346673 CTGTGGCCAGGGAGAAGAGTAGG - Intergenic
1127617049 15:60696535-60696557 CGGTGGGCTGGGAGAAAAGGAGG - Intronic
1128260478 15:66229404-66229426 CTGTTGCCAGGCAGAAATGTGGG + Intronic
1128673608 15:69593226-69593248 CTGTGGGTGGTCAGAAAAGGAGG + Intergenic
1128729868 15:70013889-70013911 GTGTGGGCAGGGAGAGAGGGAGG + Intergenic
1129176405 15:73842657-73842679 CTTTGGGCAGGCAGCAATGGTGG + Intergenic
1129235101 15:74219043-74219065 CAATGGGCAGACAGAAAATGGGG + Intergenic
1129312011 15:74719438-74719460 CTGTAGGGAGGAAGAAGAGGAGG - Intergenic
1129663524 15:77566584-77566606 ATGTGGACACGGAGAAAAGGAGG + Intergenic
1129706230 15:77796054-77796076 CTGTGGGGAGAAAGAAGAGGTGG + Intronic
1129744395 15:78007990-78008012 CTGTGAGCAGGCAGGCCAGGCGG + Intronic
1130719414 15:86372089-86372111 CTGGGGCCAGGCAGAGATGGTGG + Intronic
1130968137 15:88712085-88712107 CTGAGTTAAGGCAGAAAAGGTGG + Intergenic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1131354391 15:91732117-91732139 CTGGGTGTAGGCAGAAATGGTGG - Intergenic
1131409806 15:92198040-92198062 TTGCTTGCAGGCAGAAAAGGGGG - Intergenic
1131638243 15:94260486-94260508 TTGTGGGCAGACAGTAAATGGGG + Intronic
1131762574 15:95640485-95640507 CTATGGGAAGGCAGCAAAAGAGG - Intergenic
1133008608 16:2897972-2897994 CTGGGGTCAGCCAGAACAGGTGG + Intronic
1133278593 16:4652479-4652501 CTGTGGGCAGGAAGAAGGAGAGG + Intronic
1133370829 16:5244430-5244452 ATGTGGGCAGGCAGGGTAGGTGG + Intergenic
1133919772 16:10141623-10141645 CTGTAGGAAGTCAGACAAGGTGG - Intronic
1134198556 16:12178339-12178361 CTGTTAGCAGCCAGAAGAGGTGG + Intronic
1135598458 16:23761364-23761386 CTTTGGGAAGCCAAAAAAGGGGG - Intergenic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1136543408 16:30941836-30941858 CTGTGGGCAGGCAGAGTGGGGGG + Intronic
1136688328 16:32009188-32009210 GTGTGGGCAGGCACACACGGCGG + Intergenic
1136788927 16:32952743-32952765 GTGTGGGCAGGCACACATGGCGG + Intergenic
1136880885 16:33901191-33901213 GTGTGGGCAGGCACACATGGCGG - Intergenic
1137944205 16:52718050-52718072 CTGTGTGCGGTCAGGAAAGGAGG + Intergenic
1138125302 16:54433569-54433591 GTGAGGCCAGGAAGAAAAGGGGG - Intergenic
1138548886 16:57736260-57736282 CAGGGGGCAGGGAGAAAAGGGGG + Intronic
1139448552 16:67013623-67013645 GTGGGGGCAGGAAGACAAGGTGG - Intergenic
1139721502 16:68859692-68859714 CTGTGGGAAGGCAGAAAATGTGG + Intronic
1141743385 16:85909386-85909408 CTGTGGTCAGGCAGCAAGTGGGG - Intronic
1141977322 16:87525600-87525622 TTCTGTGCAGACAGAAAAGGTGG + Intergenic
1142157310 16:88538460-88538482 CTGTGCTGAGGCAGAGAAGGGGG - Intergenic
1203091126 16_KI270728v1_random:1214232-1214254 GTGTGGGCAGGCACACATGGCGG + Intergenic
1142504144 17:352280-352302 CTGGGGTCAGGCAGAGAATGGGG - Intronic
1143115848 17:4581575-4581597 CTGGGGGCAGGCGGAGAAGTGGG + Intergenic
1143448562 17:7022637-7022659 CTGTGTTAAGGGAGAAAAGGGGG - Intergenic
1145398347 17:22512836-22512858 CTGTGGTCAGGCAGGCAAGTGGG + Intergenic
1146853069 17:36240029-36240051 GTGGGGGCAGGTAGAAAGGGAGG + Intronic
1146868979 17:36363909-36363931 GTGGGGGCAGGTAGAAAGGGAGG + Intronic
1147071854 17:37964544-37964566 GTGGGGGCAGGTAGAAAGGGAGG + Intergenic
1147083381 17:38044070-38044092 GTGGGGGCAGGTAGAAAGGGAGG + Intronic
1147099325 17:38168041-38168063 GTGGGGGCAGGTAGAAAGGGAGG + Intergenic
1147133921 17:38424530-38424552 TTGGGGGTAGGCAGAGAAGGAGG - Intergenic
1147847849 17:43417786-43417808 CTGCAGGGAGGCAGAAAAGCGGG + Intergenic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148137113 17:45300645-45300667 CTGTGGGCAGGCAGAAAAGGAGG - Intronic
1149007720 17:51822784-51822806 TGTTAGGCAGGCAGAAAAGGAGG + Intronic
1150082339 17:62251338-62251360 GTGGGGGCAGGTAGAAAGGGAGG + Intergenic
1150260158 17:63782662-63782684 CTGTGGGAAAGGAGAAACGGGGG - Intronic
1150879641 17:69009370-69009392 CTGTGGGCAGAGAGAACAGCAGG + Intronic
1150980629 17:70137796-70137818 CTGTGGGCAGACAGCAAGTGAGG + Intergenic
1151671006 17:75571687-75571709 CTGTGGGCTGGCACCAATGGGGG + Exonic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1152640260 17:81446385-81446407 CTGTGGGTAACCAGAAAAGGGGG - Intronic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155118864 18:22798145-22798167 CTTTGGGCAGGCGGATCAGGAGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1157559536 18:48636836-48636858 CTGTGGGCAGGGAGTTAGGGAGG - Intronic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1157869716 18:51218768-51218790 CTGGAGGCAGGAAGAACAGGAGG + Intergenic
1159137687 18:64356209-64356231 CTTTGGCCAGGTAGAAAAGAAGG + Intergenic
1159833186 18:73303481-73303503 ATGTGGGGAGGAAGAAGAGGAGG - Intergenic
1160519570 18:79496833-79496855 CTGTGGGCAGGCAGAACTGCCGG + Intronic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1161293918 19:3510059-3510081 CTGGGGGCAGGAGGACAAGGTGG - Intronic
1161323917 19:3653862-3653884 CTGTGGGCAGGCAGGGAGTGTGG - Intronic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1163336177 19:16673405-16673427 CTGTGGGAAGCCACAAAATGTGG - Intronic
1163505413 19:17703079-17703101 CTGTTGGCTGGAAGAAAATGGGG - Intergenic
1163719140 19:18890063-18890085 CTGTGGGCTGGGAGCAGAGGAGG - Intronic
1163758553 19:19120862-19120884 CTGTGGGCAGGTAGCAGGGGTGG + Intronic
1164028725 19:21380567-21380589 CTCTGAGCAGGCACATAAGGTGG + Intergenic
1164242941 19:23406251-23406273 GAGGGTGCAGGCAGAAAAGGGGG + Intergenic
1164281241 19:23770598-23770620 CAGGGTGCAGGCAGAAAAGGGGG - Intronic
1164419438 19:28075754-28075776 CTCTGGCCAGGTAGAATAGGTGG + Intergenic
1164754994 19:30682678-30682700 CTGAGGGGAGGCAGAGAGGGAGG - Intronic
1166562803 19:43744536-43744558 CTGAGGCCAGGCAGGAAGGGAGG + Intronic
1166852957 19:45769092-45769114 CTGGGGGGAGGCAGAAAGCGCGG - Exonic
1166858065 19:45792937-45792959 CTGTGGGCGGGGCGAGAAGGTGG + Intergenic
1166956901 19:46470915-46470937 CTGTGGGCAGGCAGAAATTGAGG - Exonic
1167172611 19:47843273-47843295 CTGTGGGTGGACAGAGAAGGGGG - Exonic
1167277992 19:48550407-48550429 CTGATGGTAAGCAGAAAAGGAGG - Intergenic
1167650895 19:50728046-50728068 CTGTGGGCATGCAGAGAGAGAGG + Intergenic
1168075544 19:53979181-53979203 ATGAGGCCAGGCAGAAAAAGCGG + Intronic
1168136014 19:54352305-54352327 GTGTGGCCAGGCAGAGAGGGAGG - Exonic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
925027264 2:619946-619968 CTGTGGGCATGCAGGAAGAGGGG + Intergenic
925049197 2:798009-798031 CTGTGGCCCGGCAGAGAAGGAGG - Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925333492 2:3076546-3076568 CTCTGAACAGGCAGAAAAGTGGG + Intergenic
927650947 2:24913423-24913445 TTGGGGGCAGCCAGAAAAGTAGG + Intronic
927670842 2:25067664-25067686 CTGTGGCCAGGCAGATCACGAGG - Intronic
928875899 2:36039109-36039131 CAGTGAGCAGGCAGGAAAAGAGG - Intergenic
929904897 2:46037023-46037045 CTGTGGGAAGGCAGGCGAGGAGG - Intronic
929927969 2:46230909-46230931 CTGGGGACAGGAAGTAAAGGCGG + Intergenic
930195499 2:48505926-48505948 CAGTGGGCAGCCAGGAAAGCAGG + Intronic
932074575 2:68651059-68651081 CTGAGGGCAGGAGGAAAATGAGG + Intronic
933995149 2:87662756-87662778 TTGTTAGCAGGCTGAAAAGGAGG - Intergenic
935817060 2:106856321-106856343 CTGTGGGAAGGATTAAAAGGTGG - Intronic
936298712 2:111288157-111288179 TTGTTAGCAGGCTGAAAAGGAGG + Intergenic
936626285 2:114152889-114152911 CTCTTATCAGGCAGAAAAGGAGG + Intergenic
936801590 2:116274678-116274700 ATGCCAGCAGGCAGAAAAGGAGG - Intergenic
937000133 2:118458173-118458195 CTTTGGCCAGGCAGCTAAGGAGG - Intergenic
937027452 2:118711272-118711294 CTGTTGGCAGGGAGAAGAGGAGG - Intergenic
938063188 2:128267661-128267683 TTGGGGGCAGCCAGAAGAGGAGG + Exonic
938296822 2:130183832-130183854 CTGCGGGCTGGAGGAAAAGGAGG - Intronic
938370416 2:130764601-130764623 CTGTGGCCAGCCAGAAGTGGGGG + Exonic
938444704 2:131367711-131367733 CTGTGGCCCAGCAGAAAAGCTGG + Intergenic
939290342 2:140186109-140186131 CTGGGGGCAGAGAGAAATGGAGG + Intergenic
939404131 2:141733765-141733787 TTTTAGGCAGGCAGAAAAGAAGG - Intronic
939774408 2:146366443-146366465 CTGCTGGCAAGCAGAAAATGAGG - Intergenic
940967475 2:159855782-159855804 CTGTGGCCAGAATGAAAAGGGGG - Intronic
941934923 2:170974740-170974762 CTGTGAGCAGGAGGGAAAGGCGG + Intergenic
942323141 2:174753509-174753531 CTGTGGGCAGGTAGAATACCAGG + Exonic
942507626 2:176660300-176660322 GTGTGGGAGGGCAGAAAGGGAGG + Intergenic
943440746 2:187924646-187924668 CTTTGGCCAGCCAGAAAAAGGGG + Intergenic
944196339 2:197058005-197058027 CTGTGAGCTGGCAGAAATGCAGG - Intronic
944414063 2:199466332-199466354 CTCTGGGAAAGCAGAAAATGGGG - Intronic
945974322 2:216258846-216258868 CTGCAGGCAGCCAGAAAAGGAGG - Exonic
946114128 2:217446782-217446804 CTCTGGGCAGACAGACAAGTTGG + Intronic
946160777 2:217834695-217834717 CTGGATGCAGGCAGAAATGGAGG + Intronic
946540334 2:220677245-220677267 GTGAGGGATGGCAGAAAAGGTGG - Intergenic
946892043 2:224286827-224286849 CTGTGCTGAGGCAGTAAAGGCGG + Intergenic
1169150596 20:3286475-3286497 GTGGGGGCAGGCAGTAAAGGAGG + Intronic
1169197460 20:3691254-3691276 CTCTTGGCAGACAGAAGAGGAGG + Intronic
1172493399 20:35359958-35359980 CTGTGGGCAAACAGACAAGTTGG + Intronic
1173654860 20:44692992-44693014 CTGTGAGTAGGCAGTGAAGGTGG - Intergenic
1174891345 20:54398457-54398479 GTGTGGGTACCCAGAAAAGGCGG + Intergenic
1175284772 20:57830689-57830711 CAGTGGTCAGGCAGAGAGGGCGG + Intergenic
1175466862 20:59195220-59195242 CTGGGGGCAGAGAGAAAAGGGGG + Intronic
1175644048 20:60656535-60656557 CTGTGGGCAGGCAGATGAGAGGG + Intergenic
1177203484 21:17984077-17984099 CTGTGGAGAGGGAGAAATGGGGG - Intronic
1178226493 21:30725322-30725344 AAGTGGGGAGGGAGAAAAGGAGG + Intergenic
1178465451 21:32843507-32843529 CTCTGAGCAGACATAAAAGGGGG + Intergenic
1178473682 21:32917832-32917854 CTGTGTGCAGGCACCGAAGGAGG + Intergenic
1179168968 21:38957975-38957997 CTGTGGGCATGGAGTAAATGGGG + Intergenic
1179541227 21:42084267-42084289 TTATGGACAGGCAGCAAAGGCGG + Intronic
1180647193 22:17348913-17348935 CAGAGGGCATGAAGAAAAGGAGG - Intergenic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183393169 22:37557234-37557256 CTGGAGGCAGGCTGCAAAGGAGG + Intergenic
1184391216 22:44204685-44204707 GTGTGGCCAGGCAGATAGGGAGG + Intronic
1184645985 22:45895776-45895798 CTGAGGTCAGGCAGGGAAGGTGG + Intergenic
1185083252 22:48721283-48721305 CAGTGGGCGGGCTGAAATGGTGG - Intronic
1185162573 22:49238694-49238716 CTGGGGGCAGGCAACAAAGAGGG + Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
949911808 3:8916325-8916347 TTTGTGGCAGGCAGAAAAGGAGG - Intronic
950006020 3:9691479-9691501 TGCTGGACAGGCAGAAAAGGGGG - Intronic
950106590 3:10392651-10392673 CTGTGGGCAGTTAGAGGAGGTGG - Intronic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
950550981 3:13665742-13665764 GTGGGGGCAGGAAGACAAGGGGG + Intergenic
950615938 3:14158256-14158278 CTGTGAGCAGGAGGAAAAGTGGG - Exonic
951516645 3:23567137-23567159 CTTTCTGCTGGCAGAAAAGGGGG - Intronic
952377440 3:32779590-32779612 CTGTGGTGAGGAAGAAAGGGTGG - Intergenic
953552144 3:43911506-43911528 CTTTGGTCAGGGAGAAAATGAGG - Intergenic
953914032 3:46906584-46906606 GTGTGGACAGACAGGAAAGGGGG + Intergenic
954409720 3:50365185-50365207 CTGCGGGCAGCCCGGAAAGGCGG + Intronic
955272603 3:57516557-57516579 ATGTGGGCAGTGAGAAAAAGAGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
957072124 3:75575642-75575664 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
958710827 3:97715126-97715148 CTGATGGCAGACAGAAAAGGAGG - Intronic
960335016 3:116406704-116406726 CTGTGTGCATGGAGAACAGGAGG - Intronic
960690202 3:120338903-120338925 CTGTGGGCAGGAATAGAAGGAGG + Intronic
961282017 3:125771443-125771465 ATGTGGGCAGGCAGGGTAGGTGG + Intergenic
961557110 3:127703262-127703284 CTGTGAGAAGGCAGAGAATGTGG - Intronic
961649791 3:128411578-128411600 ATGTGGGCAGGCAGGTGAGGGGG - Intergenic
962799239 3:138875896-138875918 CTGTGGCCAGGAGGAAAAGTGGG - Intergenic
962921833 3:139957311-139957333 CTGTGGGTAGGGAGAAGATGAGG - Intronic
963087408 3:141451017-141451039 CAGTGGGCAAGCAAAGAAGGGGG + Intergenic
963480522 3:145867797-145867819 ATGTGGGCAGGCTGACAATGAGG - Intergenic
964529131 3:157648173-157648195 CTGTAGGCAAGAAGACAAGGTGG - Intronic
965246003 3:166269426-166269448 ATGTGGAAAGGCAGAAAATGGGG + Intergenic
965516603 3:169628669-169628691 CAGGGGCCAGGCTGAAAAGGCGG + Intronic
966547900 3:181171357-181171379 CTGTGGGTAGGAAGAAAGGAAGG + Intergenic
966967331 3:185007174-185007196 CTGTGGGAAGGAGGAAGAGGGGG - Intronic
968277402 3:197451059-197451081 CTGTGGGCAGGATGCAAAAGGGG + Intergenic
968766617 4:2474471-2474493 CTGTGGACAGGCAAAGAAAGTGG + Intronic
969015714 4:4102963-4102985 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
969261458 4:6036778-6036800 ATTTAGGAAGGCAGAAAAGGAGG - Intronic
969620698 4:8277377-8277399 CAGTGGGCAGGAAGCAAATGAGG - Intronic
969711052 4:8844132-8844154 CTGGGAGTAGGGAGAAAAGGTGG + Intergenic
969738248 4:9005398-9005420 ATGTGGGCAGGCAGGGCAGGTGG + Intergenic
970295676 4:14626933-14626955 CTGCAGTCAGACAGAAAAGGTGG - Intergenic
971110327 4:23577916-23577938 CTGTGGACTGGCAGAATACGGGG - Intergenic
971381603 4:26103644-26103666 CTGTGTGCAGAGAGAAGAGGTGG - Intergenic
972032864 4:34484078-34484100 CTGGGGGAAGGAAAAAAAGGAGG + Intergenic
972284646 4:37636664-37636686 CTCTGGCCCAGCAGAAAAGGAGG + Intronic
975715264 4:77199453-77199475 CTGTGGGGAGGCTGAAGAGCAGG + Intronic
976454334 4:85228726-85228748 CTGTGGGCTGGCACAAGAGTAGG - Intergenic
977453392 4:97226674-97226696 CTCGTAGCAGGCAGAAAAGGAGG - Intronic
978295953 4:107205460-107205482 CTGATGGCAGGCAGAAAAATGGG - Intronic
979011617 4:115377693-115377715 CTGTGGGCCGAGGGAAAAGGTGG - Intergenic
980717357 4:136644380-136644402 CTGTTTTCAGGAAGAAAAGGGGG - Intergenic
981746961 4:148061632-148061654 CTTTGGTCAGGAAAAAAAGGGGG - Intronic
981999941 4:151013263-151013285 AGGTGGGTAGGTAGAAAAGGGGG + Intronic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
985893874 5:2737964-2737986 CTGTCAGCAGGCAGGACAGGTGG - Intergenic
985995155 5:3593626-3593648 CTGTGGGGAGGCAGGAATAGGGG - Intergenic
987654006 5:20782621-20782643 ATCTGGGAAGGCAGAAAGGGAGG + Intergenic
988741569 5:34078871-34078893 ATTTGGGAAGGCAGAAAGGGAGG - Intronic
990694198 5:58396815-58396837 CTCTTATCAGGCAGAAAAGGAGG + Intergenic
990872957 5:60453702-60453724 TTGTCAACAGGCAGAAAAGGAGG - Intronic
992541144 5:77765431-77765453 CTCTGGGAACACAGAAAAGGGGG + Intronic
992755112 5:79896893-79896915 CTGAGGGCAAACAGAAAAGCTGG + Intergenic
993520032 5:88889395-88889417 CCGTCGGCCGGGAGAAAAGGGGG - Intronic
994569962 5:101503580-101503602 CTCTGGACTGGCAAAAAAGGTGG + Intergenic
997142575 5:131398319-131398341 CTGTGGTCTGGAATAAAAGGGGG + Intronic
997303660 5:132823872-132823894 CTGTGGGGAGGCTGGAGAGGAGG - Exonic
997691622 5:135831258-135831280 CTGGTGGCTGGCAGACAAGGAGG - Intergenic
997719920 5:136070100-136070122 CTCTGGGCTGGGAGGAAAGGGGG + Intergenic
997976724 5:138445445-138445467 CTGGGTGCAGGGAGAAAAGGAGG - Intronic
998113425 5:139519105-139519127 GTTTAGGCAGGTAGAAAAGGTGG - Intergenic
999289073 5:150411751-150411773 TTGGGGGCAGGCAAGAAAGGAGG - Intronic
999467601 5:151822420-151822442 CTGAGGGCTGGGAGGAAAGGAGG - Intergenic
999477611 5:151915274-151915296 CTGAGGGAAGGCAGAAGAGAAGG + Intronic
999652468 5:153780985-153781007 CGGAGGGCAGGCAGAAAGGAAGG + Intronic
1000129046 5:158277002-158277024 CTGTGGGGAGGGAGAAAGAGTGG + Intergenic
1001498244 5:172205922-172205944 ATGGGGGCAGGGAGAAAAGATGG + Intergenic
1002379800 5:178818358-178818380 CCATGTGCGGGCAGAAAAGGTGG + Intergenic
1002946035 6:1762192-1762214 CTTTGTGGAGGCAGAAAATGTGG - Intronic
1005482454 6:26267620-26267642 ATGTGTTCAGGGAGAAAAGGAGG - Intergenic
1005926469 6:30449588-30449610 ATGTGGGCAGGGAGAAGAGGAGG + Intergenic
1005936788 6:30529186-30529208 CTGTGGCCAGGAAGAAAACAAGG - Intergenic
1007816278 6:44527724-44527746 CTGTGGGCAAGCAAACTAGGAGG - Intergenic
1011286100 6:85724855-85724877 CTTTGGGAAGGCAACAAAGGTGG - Intergenic
1012119908 6:95353865-95353887 AAGAAGGCAGGCAGAAAAGGAGG + Intergenic
1012976634 6:105787101-105787123 CTGTTGGCTGCAAGAAAAGGTGG - Intergenic
1015556392 6:134465922-134465944 CTGTGCTCAGGAGGAAAAGGAGG - Intergenic
1015962669 6:138666355-138666377 CTTTGGGCAGGCAGATCATGAGG + Intronic
1016252460 6:142060599-142060621 ATGTGGAGAGGCAGAAAATGAGG + Intronic
1017165877 6:151408062-151408084 CAGTGGACATGAAGAAAAGGTGG + Intronic
1018063088 6:160105519-160105541 CTGCTGGCAGGAAGAAACGGTGG - Exonic
1018345405 6:162893757-162893779 CTGTGGGCAGTCAGATATGATGG + Intronic
1018414190 6:163587076-163587098 CTGTGGCCAGGCACAGAACGGGG - Intergenic
1019465441 7:1185636-1185658 CTGAGGGTGGACAGAAAAGGCGG - Intergenic
1019491570 7:1316238-1316260 CTGTGGGCAGGCAGAGTGGGTGG + Intergenic
1019594803 7:1853576-1853598 CTGTGGTCAGGCAGGCAGGGTGG - Intronic
1019717953 7:2549550-2549572 CTGATGGAGGGCAGAAAAGGAGG + Intronic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1021350639 7:19589829-19589851 CTGTAGGCATTCAGATAAGGGGG + Intergenic
1022323746 7:29311036-29311058 CTGAGGACAGACAGAAAAGCAGG - Intronic
1022913920 7:34927682-34927704 CTGGGGGCAGGAGAAAAAGGAGG + Intergenic
1023256784 7:38320191-38320213 GAGGGGGCAGGCAGAAGAGGAGG + Intergenic
1023878737 7:44306924-44306946 GTGTGAGCAGGAAGAGAAGGGGG + Intronic
1023878858 7:44307378-44307400 GTGTGAGCAGGGAGAAGAGGGGG + Intronic
1026295338 7:69047290-69047312 CTGTGAGCAGGGAGAACAGCTGG + Intergenic
1026731684 7:72917470-72917492 CTCTGGGAAAGCAGAAAAGCTGG - Intronic
1026731690 7:72917502-72917524 CTCTGGGAAAGCAGAAAAGCTGG - Intronic
1026847269 7:73705223-73705245 CTCTGGGGAGGTAGAAAGGGTGG + Exonic
1027669452 7:81077803-81077825 CTGTGGGGTGACAGAACAGGTGG - Intergenic
1029074383 7:97924597-97924619 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1029236195 7:99121542-99121564 CTGGGGGCGGGGAGAAGAGGAGG - Intronic
1030568173 7:111187195-111187217 CTGTGGGCAGCAAGAAAATTAGG + Intronic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1031408845 7:121419197-121419219 AGGTGAGCAGGCAGAAGAGGTGG - Intergenic
1032949180 7:136887956-136887978 CTTTGGGAAGGCAGAACTGGAGG + Intronic
1033244802 7:139708598-139708620 CTGTGGCAAGGCAGAAAACTGGG + Intronic
1034049804 7:147970410-147970432 TTGTTAGGAGGCAGAAAAGGTGG + Intronic
1035038085 7:155908372-155908394 CTGAGGGCAGGGAGGAGAGGGGG - Intergenic
1035447469 7:158952604-158952626 CTGTGGACAGGGAGAAAAGGAGG + Intronic
1035447482 7:158952673-158952695 GTGTGGACAGGGAGAAAAGGAGG + Intronic
1035447495 7:158952742-158952764 GTGTGGACAGGGAGAAAAGGAGG + Intronic
1035670944 8:1416810-1416832 CTGAGGAGAGACAGAAAAGGAGG - Intergenic
1036829407 8:12010499-12010521 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1037068240 8:14610269-14610291 CTGTTTTCAGGGAGAAAAGGGGG - Intronic
1037837068 8:22220722-22220744 CGGTGGGCAGGTGGAGAAGGAGG + Exonic
1038011723 8:23481393-23481415 CTGTGTGCAGGCACAACAGAGGG + Intergenic
1038629234 8:29225172-29225194 GTGTGGGAAGGCAGAAAGGCAGG + Intronic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1038800628 8:30745513-30745535 TTGTGAGCAGGGAGAAAATGTGG - Intronic
1039327036 8:36496900-36496922 TTTTGGGGAAGCAGAAAAGGAGG - Intergenic
1040007367 8:42631636-42631658 CTGTGGCCAGGGAGAAGTGGTGG + Intergenic
1040283728 8:46088993-46089015 CTGTGGGCATGCAGAAACTCAGG + Intergenic
1040284939 8:46094784-46094806 GTGTGGGCAGGCAGAAACTCAGG + Intergenic
1040318298 8:46276437-46276459 GTGTGGGCAGGCAGAAACACGGG - Intergenic
1040319846 8:46286989-46287011 CAGTGGGCAGGCAGAAACTCAGG - Intergenic
1040328583 8:46374642-46374664 GTGTGGGCAGGCAGAAACTCAGG - Intergenic
1040901294 8:52419625-52419647 CTGGGTGCAGGGAGAAAAGAAGG - Intronic
1041406228 8:57502196-57502218 TTGGGGGCAGGCAGGAAATGTGG + Intergenic
1041428286 8:57748450-57748472 CTTTAGGGAGGCAGAAAAGGAGG - Intergenic
1043951427 8:86313613-86313635 CAATGGTCAGGCAGAAAATGAGG + Intronic
1045218191 8:100169855-100169877 CTGTGGGCAGGCTGCCTAGGGGG - Intronic
1045323634 8:101100829-101100851 CTGAGGACAGGTAGAGAAGGGGG - Intergenic
1045506903 8:102785191-102785213 CTGTTGGCAGGCAGTGAGGGGGG - Intergenic
1046487366 8:114904225-114904247 CTGTTGTGAGTCAGAAAAGGAGG + Intergenic
1048134011 8:131728373-131728395 CTGTGGTCAAGCAGCAAGGGAGG + Intergenic
1048246027 8:132800931-132800953 CTGTAGGTAGGGAGAAAAAGAGG - Intronic
1048779349 8:137984677-137984699 GTGTGGGCAGAGAGAAAAGGGGG - Intergenic
1048907766 8:139104842-139104864 CTGTGGGCACCCAGAAGAGATGG - Intergenic
1049069968 8:140348977-140348999 CTGTTGACAGACAGAAAAAGAGG + Intronic
1049139058 8:140934932-140934954 CTGTGTTTATGCAGAAAAGGAGG + Intronic
1049356979 8:142193826-142193848 CAGGGGGCAGCCAGATAAGGAGG + Intergenic
1049480062 8:142818351-142818373 CAGTGGGCAGGCAGCAGAGGAGG - Intergenic
1049487528 8:142874312-142874334 CTGGGGTCAGGCAGAAAGGGAGG + Exonic
1051130065 9:13850856-13850878 GTGGGGGCAGGCAGAGAAGAAGG - Intergenic
1051796132 9:20872541-20872563 ATGTAGGCATGCAGAAGAGGAGG - Intronic
1051845937 9:21451219-21451241 TTAAGGGCAGGCAGAAGAGGAGG - Intergenic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1054473595 9:65557454-65557476 CTGCAAGCAGGCAAAAAAGGGGG - Intergenic
1054742848 9:68826264-68826286 CTGGGGCCAGGCAGCAAAGAAGG + Intronic
1055928106 9:81531523-81531545 CTGTGAGGAGAGAGAAAAGGAGG + Intergenic
1056153067 9:83806561-83806583 CTGTGGGGAGGCAGAAGAGTAGG + Intronic
1057014860 9:91642621-91642643 CTGCAGGCAGGCAGAGCAGGGGG - Intronic
1057308231 9:93924922-93924944 CGGAGGGCAGGCACAAAGGGTGG - Intergenic
1057691231 9:97288447-97288469 CTTTGGGCAGGCATAAGAGGAGG - Intergenic
1059286105 9:113172960-113172982 CTTTGGTAAGGCAGCAAAGGAGG - Intronic
1059907019 9:118998628-118998650 CTATTGACAAGCAGAAAAGGGGG + Intergenic
1060211339 9:121712361-121712383 CTTTGGGCTGCCAGAAAAGAGGG - Intronic
1060539588 9:124420466-124420488 CTGTGTGCTGGCAGAATACGAGG - Intergenic
1061028408 9:128065450-128065472 CTATGGCGAAGCAGAAAAGGAGG + Intronic
1061764894 9:132875407-132875429 CTATGGGGAGGCAGAAGTGGAGG + Intronic
1061847298 9:133394901-133394923 CTGTGGGCAGGAAGGAGGGGAGG + Intronic
1062172656 9:135144102-135144124 ACGTGGGAGGGCAGAAAAGGAGG - Intergenic
1062665353 9:137668101-137668123 CAGTGGGGAGGCAGACAAGTAGG + Intronic
1186190432 X:7062595-7062617 CTGGGGGCAGGCAGAAGACAAGG + Intronic
1186249926 X:7654852-7654874 CTTTGGGCAGACAGAAATGGAGG + Intergenic
1186684985 X:11916530-11916552 ATGTGGGGAGGCAGAAAGAGGGG + Intergenic
1187246896 X:17560984-17561006 TGGTGGGCAGGCATGAAAGGGGG - Intronic
1188065520 X:25654878-25654900 CTGTGGGCAGGTAGTTGAGGAGG - Intergenic
1188068052 X:25685881-25685903 CTGCGGGAAGGCAGTGAAGGTGG + Intergenic
1190170442 X:48108069-48108091 ATGGGGGCAGATAGAAAAGGAGG + Intergenic
1190450161 X:50571448-50571470 CAGTGTGCAGGCAAAAGAGGTGG + Intergenic
1192899983 X:75486514-75486536 AGGTGGGCAGGCAGGCAAGGAGG + Intronic
1193797412 X:85892757-85892779 ATGTGGTCAGGCAGAAAAGTGGG - Intronic
1195398092 X:104432724-104432746 CTGGAGTCAGGAAGAAAAGGGGG - Intergenic
1196333379 X:114498968-114498990 CTGAGGACAGGCAGAGAAAGGGG + Intergenic
1198080802 X:133237420-133237442 CGGTGGGGAGGAAGAGAAGGAGG + Intergenic
1198424103 X:136497484-136497506 CGGTGGGCGGGCAGAGAGGGGGG + Intronic
1199529636 X:148831798-148831820 CTGTGAGGAGCCAGAAAAGGGGG - Intronic
1199614060 X:149641192-149641214 CTGTGTTCAGGAAGGAAAGGAGG + Intergenic
1200105739 X:153711049-153711071 CTGGGGGCAGCAAGGAAAGGAGG - Intronic
1200745485 Y:6900268-6900290 CTGTGGGCAGGCGGGCAAGGAGG + Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic