ID: 1148140241

View in Genome Browser
Species Human (GRCh38)
Location 17:45323053-45323075
Sequence GACCCCTGGGTTGGAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148140234_1148140241 -7 Left 1148140234 17:45323037-45323059 CCAGGAATCCAGCTGCGACCCCT No data
Right 1148140241 17:45323053-45323075 GACCCCTGGGTTGGAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148140241 Original CRISPR GACCCCTGGGTTGGAGGGAC TGG Intergenic
No off target data available for this crispr