ID: 1148141735

View in Genome Browser
Species Human (GRCh38)
Location 17:45333864-45333886
Sequence AGGAATCAGGAGCAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148141725_1148141735 27 Left 1148141725 17:45333814-45333836 CCTGGCCTGGGCTGCAGGACTGA No data
Right 1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG No data
1148141726_1148141735 22 Left 1148141726 17:45333819-45333841 CCTGGGCTGCAGGACTGATGAAT No data
Right 1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148141735 Original CRISPR AGGAATCAGGAGCAGGAGGC GGG Intergenic
No off target data available for this crispr