ID: 1148143220

View in Genome Browser
Species Human (GRCh38)
Location 17:45342869-45342891
Sequence TTCCTGCCTTGCTAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148143214_1148143220 -4 Left 1148143214 17:45342850-45342872 CCCAGCCTTCTCAGATTCTTTCC No data
Right 1148143220 17:45342869-45342891 TTCCTGCCTTGCTAGGAGGGTGG No data
1148143215_1148143220 -5 Left 1148143215 17:45342851-45342873 CCAGCCTTCTCAGATTCTTTCCT No data
Right 1148143220 17:45342869-45342891 TTCCTGCCTTGCTAGGAGGGTGG No data
1148143216_1148143220 -9 Left 1148143216 17:45342855-45342877 CCTTCTCAGATTCTTTCCTGCCT No data
Right 1148143220 17:45342869-45342891 TTCCTGCCTTGCTAGGAGGGTGG No data
1148143213_1148143220 4 Left 1148143213 17:45342842-45342864 CCACTGTGCCCAGCCTTCTCAGA No data
Right 1148143220 17:45342869-45342891 TTCCTGCCTTGCTAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148143220 Original CRISPR TTCCTGCCTTGCTAGGAGGG TGG Intergenic
No off target data available for this crispr