ID: 1148144343

View in Genome Browser
Species Human (GRCh38)
Location 17:45353216-45353238
Sequence AAGGGGAAACACACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148144343_1148144356 23 Left 1148144343 17:45353216-45353238 CCCTCCTCAGTGTGTTTCCCCTT No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148144343 Original CRISPR AAGGGGAAACACACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr