ID: 1148144356

View in Genome Browser
Species Human (GRCh38)
Location 17:45353262-45353284
Sequence CACACTTATCCACAGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148144349_1148144356 4 Left 1148144349 17:45353235-45353257 CCTTGGCTTCCCCATCCCACACG No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144351_1148144356 -6 Left 1148144351 17:45353245-45353267 CCCATCCCACACGTGACCACACT No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144348_1148144356 5 Left 1148144348 17:45353234-45353256 CCCTTGGCTTCCCCATCCCACAC No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144350_1148144356 -5 Left 1148144350 17:45353244-45353266 CCCCATCCCACACGTGACCACAC No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144342_1148144356 29 Left 1148144342 17:45353210-45353232 CCTCTTCCCTCCTCAGTGTGTTT No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144352_1148144356 -7 Left 1148144352 17:45353246-45353268 CCATCCCACACGTGACCACACTT No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144346_1148144356 19 Left 1148144346 17:45353220-45353242 CCTCAGTGTGTTTCCCCTTGGCT No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144344_1148144356 22 Left 1148144344 17:45353217-45353239 CCTCCTCAGTGTGTTTCCCCTTG No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144343_1148144356 23 Left 1148144343 17:45353216-45353238 CCCTCCTCAGTGTGTTTCCCCTT No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data
1148144347_1148144356 6 Left 1148144347 17:45353233-45353255 CCCCTTGGCTTCCCCATCCCACA No data
Right 1148144356 17:45353262-45353284 CACACTTATCCACAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148144356 Original CRISPR CACACTTATCCACAGAACAA AGG Intergenic
No off target data available for this crispr