ID: 1148151490

View in Genome Browser
Species Human (GRCh38)
Location 17:45398932-45398954
Sequence CTGGAGTGTGGGAGGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1076
Summary {0: 1, 1: 1, 2: 10, 3: 109, 4: 955}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148151490 Original CRISPR CTGGAGTGTGGGAGGTGGTG GGG (reversed) Intronic
900296809 1:1956059-1956081 CTGGAGTGAGGGAGGCTGAGGGG - Intronic
900314854 1:2051422-2051444 CCGAAGTGTGGGCGGTGGGGAGG + Intronic
900353607 1:2249048-2249070 CTGGAGTGTGCGAGGCTGTCAGG + Intronic
900468385 1:2837185-2837207 CTGGAGGGTGGGGGATGGTTTGG + Intergenic
900496251 1:2977397-2977419 CTGGATGGTGGGTGCTGGTGTGG + Intergenic
900496283 1:2977516-2977538 CTGGATGGTGGGTGCTGGTGTGG + Intergenic
900496361 1:2977800-2977822 CTGGATGGTGGGTGCTGGTGTGG + Intergenic
900569022 1:3349273-3349295 CTGGTGTCAGGGAGGAGGTGTGG + Intronic
900649003 1:3721998-3722020 CTGGAGTGGGGGAGAGGGAGCGG - Intronic
900815196 1:4838189-4838211 CTGGGTTGGGGGTGGTGGTGAGG + Intergenic
901005932 1:6171512-6171534 CGGGAGCGTGTGAGGTGTTGGGG - Intronic
901220367 1:7580281-7580303 CTGGACCGTGGGAGCTGTTGGGG + Intronic
901292406 1:8134381-8134403 CTGGAGTGGAGGAGGGGGTGGGG + Intergenic
901397482 1:8991955-8991977 CTGGAGAGTGGGTGATGGGGAGG - Intergenic
901712304 1:11125169-11125191 CTGGAGTGTGGGGGTGGGTGAGG + Intronic
901730097 1:11273140-11273162 CTGGAGGGCGGGAGGGGGCGGGG - Intergenic
901788210 1:11638528-11638550 GTGGAGTGTGTGTGCTGGTGGGG - Intergenic
901814257 1:11785012-11785034 AGGGAGTGTGGGAGGTGGGTGGG + Intronic
902913469 1:19619883-19619905 CGGGTGTGTGGTAGGGGGTGGGG - Intronic
903234143 1:21938570-21938592 CCTGAGTGTGTGAGTTGGTGTGG - Intergenic
903317326 1:22518547-22518569 CTGGTGTGTGGGAAGAGGGGTGG - Intronic
903647745 1:24905050-24905072 CTGGGGTATGGGAGGTGCTGGGG + Intronic
903661941 1:24983798-24983820 CTGGAGACTGGACGGTGGTGAGG + Intergenic
903958488 1:27041304-27041326 CTGGAGTGTAGGGTGAGGTGCGG - Intergenic
904062082 1:27719589-27719611 ATTGAATTTGGGAGGTGGTGAGG - Intergenic
904578611 1:31523131-31523153 CTGAAATGTGTGAGGTGGTTGGG + Intergenic
904685110 1:32254045-32254067 GTGGGGTGGGGTAGGTGGTGAGG + Intronic
904885691 1:33736605-33736627 CAGGAGGGTGGCAGGTGGAGAGG + Intronic
905025533 1:34846975-34846997 TTGCAGGGTGGGAGGTGGGGTGG + Intronic
905210092 1:36367933-36367955 GTGAAGTGTGGGTGGTGGGGAGG + Intronic
905224883 1:36472477-36472499 CTGGAGAGCCTGAGGTGGTGGGG - Intronic
905361424 1:37423435-37423457 CTGGTGGGTTGCAGGTGGTGAGG - Intergenic
905427542 1:37896762-37896784 CCGGAGGGAGGGAGGTGGGGGGG + Intronic
905461531 1:38125914-38125936 GTGGAGTGTGGGAGGGGACGGGG + Intergenic
905473768 1:38211679-38211701 TGGGAGTGGGGGAGGTGATGGGG - Intergenic
905630195 1:39514316-39514338 CTGGAGTGGGGGAGGTGGAGAGG + Intronic
905667565 1:39771874-39771896 CTGGAGTGGGGGAGGTGGAGAGG - Intronic
905868601 1:41390344-41390366 CTTGAAAGTGGGGGGTGGTGGGG + Intergenic
905873185 1:41416433-41416455 CTGGGGTGTGGGGGGCTGTGGGG + Intergenic
906508906 1:46400177-46400199 CTGGGGTGTGGGGGGTGGGAGGG + Intronic
906711584 1:47934333-47934355 AGGGACTGTGGGAGGGGGTGTGG - Intronic
907243710 1:53094303-53094325 CTGGTGTGTGCGAGCTGGGGAGG - Intronic
907274631 1:53310344-53310366 CAGGAGGGTGGGAGGTGGGCTGG - Intronic
907720057 1:56963571-56963593 GTGGAGGTTGGGGGGTGGTGGGG + Intronic
907734683 1:57100753-57100775 CTGGGGTGGGGGTGGGGGTGGGG + Intronic
907866589 1:58405075-58405097 GTGGAGAGAGGGAGGTGGCGGGG - Intronic
908038892 1:60086109-60086131 GGGAAGTGTGGGAGGGGGTGAGG + Intergenic
909158433 1:72112771-72112793 CAGTAGTGAGGGAGGTGGAGTGG - Intronic
909961888 1:81856065-81856087 GTGGAGTTTGGAAGGTGGTGTGG + Intronic
910428267 1:87137204-87137226 ATGGTGTGGGGGAGGCGGTGGGG + Intronic
910431981 1:87167894-87167916 GTGGGGTGTGGGAGGAGGTGGGG + Intronic
910979319 1:92943512-92943534 GTGGGGTGGGGGAGGTGGTTGGG - Intronic
911015141 1:93324077-93324099 CTTGAGTGTAGGAGTTGGTTGGG - Intergenic
911104399 1:94118587-94118609 CTGGAATGTGGTAGCAGGTGGGG + Intronic
911360772 1:96873459-96873481 CAGTTGTGTGGGAGGTGGGGAGG + Intergenic
911671422 1:100613052-100613074 CTGGTGGGTGGGAGGTGTTTGGG + Intergenic
912415059 1:109502467-109502489 GTGGTTTGGGGGAGGTGGTGAGG + Intronic
912497019 1:110098343-110098365 CTGGAGTGAGGCAGGAGGGGAGG - Intergenic
912716999 1:111989944-111989966 CCCGAGGGGGGGAGGTGGTGGGG + Intergenic
912775634 1:112504819-112504841 CCGGTGGGTGGGAGGTGGTGTGG - Intronic
912852768 1:113141224-113141246 ATGGGGTGTGTGAGGAGGTGGGG - Intergenic
913519294 1:119630819-119630841 CTGGAGTGCGGGGGAAGGTGGGG - Intronic
915523766 1:156464021-156464043 CCAGAGGGAGGGAGGTGGTGAGG - Exonic
915630268 1:157148737-157148759 ATGGTGTGTGGGTGGTGGTGAGG - Intergenic
915855169 1:159375792-159375814 GGAGAGAGTGGGAGGTGGTGAGG - Intergenic
915987646 1:160482268-160482290 CTTGAGGGTGGGATGGGGTGTGG + Intergenic
916192622 1:162193967-162193989 CTGGAGTGTGACAGCTGCTGAGG + Intronic
916491328 1:165304918-165304940 CTGCTGTGGGGCAGGTGGTGGGG - Intronic
916871189 1:168916774-168916796 GTGGAGTGTGGTAGGAGCTGAGG - Intergenic
917043058 1:170827818-170827840 CTGGAGTGAGGAAGGAGGAGAGG + Intergenic
917259596 1:173152917-173152939 ATGGTTTGTGGGAGGTGGTGAGG + Intergenic
917782624 1:178414294-178414316 TTGGAGTGTGGGAGGTACTGAGG + Intronic
917784029 1:178433069-178433091 CTGGGGTGTTGGAGTGGGTGAGG - Intronic
917860024 1:179135813-179135835 CGGGAGGGAGGGAGGTGGGGGGG + Intronic
917883283 1:179360382-179360404 CTGGAGTGTGTGGCGTGATGTGG + Intergenic
918488177 1:185051645-185051667 ATGGGGTGTGGGAGGAGTTGTGG + Intronic
919112443 1:193237600-193237622 GTGGCGGGTTGGAGGTGGTGTGG + Intronic
919766400 1:201130036-201130058 CTGAGCTGTGGGAGCTGGTGGGG + Intergenic
920130792 1:203730396-203730418 CTGGAGTGTGGGGTGGGGTAGGG - Intronic
920215332 1:204358715-204358737 CAGGAGGGTGGAAGGTGGTGGGG - Intronic
920228577 1:204455495-204455517 CTGGCCAGTGGGAGGGGGTGGGG - Intronic
920387488 1:205579196-205579218 CTGGGTTGTGGGCGCTGGTGTGG + Intronic
920446413 1:206022017-206022039 ATGGAGAGTGGAAGCTGGTGTGG + Intronic
920788795 1:209068786-209068808 ATGGAATATGGGAGGTGGTATGG - Intergenic
921055775 1:211541437-211541459 CTGGAGTGGAGGGGGTGATGTGG - Intergenic
921151890 1:212409301-212409323 CTGGAGGGTGGGAGGTAATCTGG + Intronic
921262662 1:213397542-213397564 CTGGGGTGTGAGGGGTGCTGAGG + Intergenic
921999633 1:221462997-221463019 CTGGGGGGAGGAAGGTGGTGGGG - Intergenic
922886947 1:229027763-229027785 TTGAAATGTGGGGGGTGGTGCGG - Intergenic
923042450 1:230329054-230329076 CTGGGGGGTGGGGGTTGGTGGGG - Intronic
923050966 1:230391146-230391168 CCTGAGTGTGGGGGGTGGGGCGG + Intronic
923144675 1:231189753-231189775 GGGGACTTTGGGAGGTGGTGAGG - Intronic
923622126 1:235587857-235587879 ATGGAGTGTGTGAGAGGGTGTGG + Intronic
923652641 1:235888421-235888443 CTAGGGTGTGGGGGGTGGTGAGG - Intergenic
923669408 1:236027360-236027382 CTGGCGTGTGGGAGCTGGACAGG - Intronic
924048622 1:240058255-240058277 ATGGAGTTTGGGAGTGGGTGAGG - Intronic
924428878 1:243979530-243979552 CAGGAGTGTGGGGGGTGGGACGG + Intergenic
1062970351 10:1643465-1643487 CTGGAGGGTGGCTGATGGTGGGG + Intronic
1063157855 10:3396645-3396667 GAGGGGTGTGGGAGGTGGTAGGG - Intergenic
1063171686 10:3515309-3515331 CTGGTGTGTGTGTGGTGGTGGGG - Intergenic
1063566801 10:7178172-7178194 CTGCTGTGTGGGTGGTGGGGAGG - Intronic
1064641271 10:17418004-17418026 CTTGAGTTTGGGAGAGGGTGTGG + Intronic
1065629185 10:27660010-27660032 CTGCAGAGTGGGAGGAGCTGTGG + Intergenic
1066104836 10:32147288-32147310 TGGGAGAGTGGGAGGGGGTGAGG - Intergenic
1067181130 10:43986679-43986701 TTGGAGTCTGGGAGGTAGGGAGG - Intergenic
1067416309 10:46106116-46106138 CTGGAGGGTGGGAGGGGGCCAGG - Intergenic
1067527485 10:47047286-47047308 CTGGAGTGTGGGTGGTGTGCGGG + Intergenic
1067830049 10:49606365-49606387 CTGGTGTGTGGGAGTTTGGGAGG - Intergenic
1068670222 10:59715035-59715057 CTGCAATGTGGTAGGTGGTAGGG - Intronic
1069512396 10:69052214-69052236 CTGGAGTGGGGAAGGTGGTGGGG + Intergenic
1069583545 10:69581420-69581442 CTGGAGTGTGGGCAGTGGGTAGG - Intergenic
1069893645 10:71667191-71667213 CGGGAGTGTGGGCGCTGGTGAGG + Intronic
1070565480 10:77600905-77600927 CTGGAGCCTGGGAGGGGGAGTGG - Intronic
1070592429 10:77810631-77810653 CTGGAGTGTGGCAGGGGAGGTGG - Intronic
1070644638 10:78193192-78193214 CTGGTTTGTGTTAGGTGGTGGGG + Intergenic
1070704990 10:78631127-78631149 CAGGAGTGAGGGAGGACGTGGGG + Intergenic
1070776870 10:79114856-79114878 GTGGGGTGTGGGTGGTGGAGTGG + Intronic
1070911573 10:80123442-80123464 AGAGAGTGTGGGAGGGGGTGAGG + Intergenic
1071193383 10:83128289-83128311 CTGGAGTGTGTGTGGGGTTGAGG - Intergenic
1071499585 10:86193828-86193850 AGGGAGGGAGGGAGGTGGTGAGG - Intronic
1071527088 10:86365234-86365256 CGGGAGGGTGGGTGGTGGAGTGG - Intronic
1071992553 10:91114171-91114193 CAGAAGTGAGGGTGGTGGTGAGG - Intergenic
1072211505 10:93250583-93250605 CTAGAGTATGGGAGATGGGGAGG + Intergenic
1072251669 10:93586669-93586691 CCGGAGTGTGGTGCGTGGTGTGG + Intronic
1072421161 10:95291241-95291263 CAGGAGGGAGGGAGGCGGTGTGG - Intergenic
1072446105 10:95500109-95500131 CGGGAGTGGGTGGGGTGGTGGGG - Intronic
1072477721 10:95779070-95779092 TTGGGGTTAGGGAGGTGGTGAGG - Intronic
1072764964 10:98087828-98087850 CAGGAGAATGGAAGGTGGTGGGG - Intergenic
1073047883 10:100651311-100651333 TGGGAGTGGGGGTGGTGGTGGGG - Intergenic
1073192151 10:101659204-101659226 GGGGAGTGAGGGAGGTGCTGGGG - Intronic
1073464823 10:103688438-103688460 CTAGAGTGTGGGAAGCGATGAGG + Intronic
1073472489 10:103731539-103731561 CTGGGTTGAGGGAGATGGTGAGG + Intronic
1074029623 10:109673255-109673277 GGGGAGAGTGGGAGGAGGTGAGG + Intergenic
1074379397 10:112966575-112966597 CTGGGGTGTGGGAATTGTTGAGG + Intronic
1074454899 10:113588277-113588299 CTGGAGTGTGGGAAGAGGCCAGG + Exonic
1074854533 10:117463751-117463773 CTGGACTGTGGTAGGTGCTTAGG + Intergenic
1075065704 10:119287700-119287722 CAGCAGTGTGGGAGTGGGTGGGG - Intronic
1075135776 10:119784849-119784871 CTGGAGTTTGGGAGGAAGTGAGG - Intronic
1075137106 10:119795080-119795102 CGGGAGGGAGGGAGGTGGGGGGG - Intronic
1075266545 10:121003828-121003850 CAGAAAGGTGGGAGGTGGTGGGG - Intergenic
1075690135 10:124388895-124388917 CTGCAGCGCGGGAGGTGGGGTGG + Intergenic
1076074476 10:127522459-127522481 CTGGGGTGGGTGGGGTGGTGAGG + Intergenic
1076101635 10:127784950-127784972 GTGGAGGGTGGGAGGAGGTTGGG + Intergenic
1076298299 10:129404359-129404381 CTGGGGTGTGGGAGTGAGTGTGG - Intergenic
1076354422 10:129841660-129841682 CTGCACTGTGGGATGGGGTGCGG + Intronic
1076370294 10:129948621-129948643 CTGGGGGGTGGGGGGAGGTGGGG + Intronic
1076648201 10:131969128-131969150 CTGGCCTGTGGGCGGTGGTGTGG + Intronic
1076804514 10:132848544-132848566 ATGGGTTGTGGGAGGGGGTGGGG + Intronic
1076827881 10:132979057-132979079 CTGGAGTGTGGTTGGATGTGAGG + Intergenic
1076864964 10:133161983-133162005 CTGGTGTGTGCGTGGGGGTGGGG - Intronic
1076948526 10:133666834-133666856 GTGGGGTGGGGGGGGTGGTGGGG - Intergenic
1076951484 10:133676742-133676764 GTGGGGTGGGGGGGGTGGTGGGG - Intergenic
1076952474 10:133680052-133680074 GTGGGGTGGGGGGGGTGGTGGGG - Intergenic
1076955430 10:133743013-133743035 GTGGGGTGGGGGGGGTGGTGGGG - Intergenic
1076956420 10:133746323-133746345 GTGGGGTGGGGGGGGTGGTGGGG - Intergenic
1076957408 10:133749632-133749654 GTGGGGTGGGGGGGGTGGTGGGG - Intergenic
1076959381 10:133756241-133756263 GTGGGGTGGGGGGGGTGGTGGGG - Intergenic
1077015577 11:397714-397736 GAGGACAGTGGGAGGTGGTGGGG - Intronic
1077094111 11:792133-792155 CTGGACTGTGCCAGGTGGGGAGG - Exonic
1077094550 11:793760-793782 CTGGTGTGTGCCAGGTGGGGCGG + Intronic
1077119503 11:900293-900315 CTGGAGAGGGAGGGGTGGTGGGG + Intronic
1077251226 11:1561567-1561589 CTGGAGTGGGGGAAGAGGAGCGG + Intronic
1077535480 11:3122147-3122169 CTGGACGGTGGGAGGAGCTGGGG - Intronic
1077991430 11:7415500-7415522 CGGGAGTGTGTGGGGTGGTGTGG + Intronic
1078053393 11:7986818-7986840 CTGGAGGGTGAGGGGAGGTGAGG - Intronic
1078441246 11:11370678-11370700 CTGGAGTGTGGGCCTGGGTGAGG - Intronic
1078530774 11:12135159-12135181 CTGGAGAGTGGGAGATGGGGTGG + Intronic
1078712573 11:13808981-13809003 CTGGAGTGTGGGCCAAGGTGGGG - Intergenic
1078750721 11:14159895-14159917 GTGGGGGGTGGGAGGTGGGGGGG + Intronic
1079345552 11:19648638-19648660 CTGGAGAGTGGTTGGTGATGGGG + Intronic
1079346102 11:19653879-19653901 GGGGAGTGTGGGAGGTGGAGTGG - Intronic
1079497742 11:21064681-21064703 GTGGAGGGTGGGGGGTGGAGAGG + Intronic
1080409296 11:32008769-32008791 GGGGAGTGTGGGAAGTGGTGAGG + Intronic
1080588844 11:33704032-33704054 CTGGAGTGGGGGAGGGGAAGGGG - Intronic
1080742964 11:35082790-35082812 TTGGGGTGTGGGAGGAGGGGCGG - Intergenic
1081347678 11:42010465-42010487 CTATAGTGAGGGAGATGGTGGGG + Intergenic
1081534571 11:43987613-43987635 AGGGAGTGGGGGAGGTGCTGTGG - Intergenic
1081580012 11:44345808-44345830 GTAAAGTGTGGGAGGTGGAGAGG - Intergenic
1081611197 11:44564687-44564709 CTGAGGTGAGGGAGGAGGTGTGG - Intronic
1081674895 11:44963090-44963112 CTGGCCAGTGGGAGGTGGAGAGG + Intergenic
1081781356 11:45715369-45715391 CTAGAGTGTGGGAAGGGGTAGGG - Intergenic
1082044649 11:47715108-47715130 CTGGTCTGGGGCAGGTGGTGAGG + Intronic
1082181791 11:49128904-49128926 CTGGGGTGGGGGAAGTGGGGAGG - Intergenic
1082212023 11:49517121-49517143 GTGGAGTGTGGGAGTCTGTGGGG - Intergenic
1083171406 11:60925636-60925658 CTGGACTGTGGGTGGGGGTGGGG - Intronic
1083251980 11:61474451-61474473 CAGGATTGTGGGAGGCTGTGAGG + Intronic
1083294243 11:61706733-61706755 CTGGGGTGGGGGTGGTGGTAAGG - Intronic
1083432854 11:62623552-62623574 CTGGAGTGCGGGGAGTGCTGTGG - Intergenic
1083676768 11:64330355-64330377 ATGGAGTGGAGGAGGTGGCGGGG + Intergenic
1083827172 11:65210462-65210484 CTGGAGGGTGGGAGGCAGTTGGG - Intronic
1083909466 11:65697595-65697617 CTGGAGTTTGGGAGGAGGTGGGG - Intergenic
1083941738 11:65899836-65899858 CTGGAGTCTGGGCTGGGGTGAGG - Intronic
1084111262 11:67015453-67015475 CTGGTGTGGAGGCGGTGGTGGGG + Intronic
1084461657 11:69299648-69299670 CTGGTGTGTCGGAGCTGGAGAGG + Intronic
1084483918 11:69437258-69437280 CTGGGGTGGGGGCAGTGGTGTGG - Intergenic
1084551188 11:69843181-69843203 CTGGGCTGTGGGGAGTGGTGGGG - Intergenic
1084565172 11:69924464-69924486 CTGGAGTATGGGAGGAGCAGAGG - Intergenic
1084612418 11:70212152-70212174 GGGGAGGGTGGGAGGGGGTGAGG - Intergenic
1084818247 11:71664007-71664029 CTGTGGTGGGGGAGGTGATGTGG + Intergenic
1084903654 11:72329235-72329257 CTGGAGTGTGTGTGGAGGGGAGG + Intronic
1085023395 11:73222765-73222787 CTGGCCTGGGGGAGGTGGTCAGG - Intronic
1085049040 11:73370496-73370518 CTTGAGTCGGGGAAGTGGTGAGG - Intergenic
1085179222 11:74519642-74519664 CTGGAGAGTGGGAGGATCTGAGG - Intronic
1086637563 11:89107392-89107414 GTGGAGTGTGGGAGTCAGTGGGG + Intergenic
1087122781 11:94592126-94592148 CTGGAGTGGGAGGGGTGGGGAGG - Intronic
1087533934 11:99419690-99419712 CTGGAGTGGGGGGAGGGGTGTGG + Intronic
1087680042 11:101210144-101210166 ATGGACAGTGGGAAGTGGTGTGG - Intergenic
1087688013 11:101287063-101287085 CTGCTGTGTGTGAGGGGGTGGGG - Intergenic
1088835749 11:113576816-113576838 CAGGAGTGTGGGAAGGGGTATGG - Intergenic
1089013365 11:115147816-115147838 GTGGAGTGTGTGTGGGGGTGTGG + Intergenic
1089013405 11:115148005-115148027 GTGGAGTGTGTGGGGGGGTGTGG + Intergenic
1089013461 11:115148318-115148340 GTGGAGTGTGTGTGGTGCTGTGG + Intergenic
1089124391 11:116166198-116166220 CAGGACTGTGGGAGGAGCTGTGG + Intergenic
1089155195 11:116396524-116396546 CTGGAGTGGGGGAAGTGCTGGGG + Intergenic
1089298094 11:117481596-117481618 CAGGAGAGTGGGAGGGGCTGAGG + Intronic
1089351124 11:117822278-117822300 CTGCAGTGGGGGGCGTGGTGGGG + Intronic
1089504347 11:118953611-118953633 CTGGGGTGGGGAAGGTGGGGGGG + Intronic
1089598095 11:119594874-119594896 CTGGAGGGTGGGAGGGGGGCAGG + Intergenic
1089670417 11:120052993-120053015 CTGGTGTGTAGGTGGTAGTGAGG - Intergenic
1089732887 11:120530381-120530403 CTGGGGTGTGGGTGGGGGTAGGG + Intronic
1089824215 11:121258984-121259006 CTGGAGGCAGGGAGGTGGGGGGG - Intergenic
1090158139 11:124463452-124463474 CTGAGGTGTGGGAGGTGGTGGGG - Intergenic
1090261905 11:125327331-125327353 CTGGAGGTGGGGAGGTCGTGAGG + Intronic
1090306395 11:125694708-125694730 CTGGAGTGTGGGTGATGGGGAGG + Intergenic
1090632090 11:128658130-128658152 CTGGAGTGAGGGAGGGTGTGTGG - Intergenic
1090708216 11:129359458-129359480 CTGGAGTTGGGGGGGTGGTGGGG - Intergenic
1090753083 11:129764249-129764271 CTGCTGTGGTGGAGGTGGTGGGG - Intergenic
1091220173 11:133926018-133926040 CAGGAGTGTGGGGGGTGCGGTGG - Intronic
1091238444 11:134036931-134036953 CTTCAGCGTGGGAGGGGGTGGGG + Intergenic
1091750685 12:3019687-3019709 CTACAGAGTGGGAGGTGGTGAGG - Intronic
1091878990 12:3960984-3961006 CTGGGCTGTTGGAGGTTGTGTGG + Intergenic
1092068883 12:5616405-5616427 GTGGTGTATGGGAGGTGATGAGG - Intronic
1092208503 12:6631481-6631503 CTGGTGTGTGAGCGGTGTTGGGG - Intronic
1092238643 12:6824546-6824568 CCGGAGAGTGGGGGGTGGTGGGG + Exonic
1092575485 12:9777962-9777984 GTGGAGTGTGGGAAGGGGTGAGG - Intergenic
1092783579 12:12008733-12008755 CTGGAGTCAGGGGGGAGGTGTGG - Intergenic
1094180347 12:27585892-27585914 CTGGAGTGTGAGGGGCAGTGGGG + Intronic
1094446770 12:30539503-30539525 GTGAAGTGTGGGAGAGGGTGAGG - Intergenic
1094490869 12:30959907-30959929 CTGGGGCATGGGAGCTGGTGGGG + Intronic
1094502881 12:31036354-31036376 ATGGTGTGTGGGAGGTTGGGCGG - Intergenic
1094633867 12:32204617-32204639 GTGGAGTGTGGGCAGTGTTGTGG - Intronic
1095189788 12:39244322-39244344 CTCGTGTGTGTGGGGTGGTGGGG + Intergenic
1095342321 12:41106351-41106373 TTGGAGTGAGGGAGATGGAGAGG - Intergenic
1095587045 12:43860997-43861019 CTGGAGGGAGGGAGGTGAGGTGG - Intronic
1095959835 12:47827414-47827436 CTGGAGTGAGGGATCTGTTGAGG - Intronic
1095983911 12:47987356-47987378 CTGGAGGGCTGGAGGTGGTTGGG - Intronic
1096258143 12:50075122-50075144 CTGGCATCTGGGAGCTGGTGGGG - Intronic
1096316852 12:50575493-50575515 CTGGAGTTTGGGAGCTGAGGTGG - Intronic
1096380823 12:51156481-51156503 CTGCAGTGTTGGAGGTGGGTGGG - Intronic
1096463280 12:51834554-51834576 CTGGGGTGGGAGATGTGGTGAGG + Intergenic
1096466785 12:51851103-51851125 GTGCAGGGTGGGAGGTGGAGGGG - Intergenic
1096685983 12:53288574-53288596 CTGGAGAATGGGAGCTGCTGAGG + Exonic
1096716114 12:53492761-53492783 CGGCGGAGTGGGAGGTGGTGGGG - Intronic
1096807742 12:54150731-54150753 AGGGGGCGTGGGAGGTGGTGTGG - Intergenic
1097264162 12:57736399-57736421 CTGGAGTGAGTCAGGTGGGGCGG - Intronic
1097279635 12:57836924-57836946 GTGGGGGATGGGAGGTGGTGGGG - Intronic
1097289650 12:57903857-57903879 CTGGAGTCTGGAAGATGATGGGG - Intergenic
1097323106 12:58246856-58246878 GTGGGGGGTGGGAGGGGGTGGGG + Intergenic
1097947499 12:65388296-65388318 CTGCAGTGTGGGCAGGGGTGTGG - Intronic
1098419510 12:70279096-70279118 AGGAAGTGTGGGAGGTGGGGAGG - Intronic
1098919335 12:76289279-76289301 ATGGAGTTTGGGAGAGGGTGTGG - Intergenic
1099255395 12:80307872-80307894 CGGGAGGGAGGGAGGTGGGGGGG - Intronic
1099301911 12:80906672-80906694 GTGCAGGGTGGGAGGAGGTGAGG + Intronic
1099664098 12:85604325-85604347 CTGTTTTGTGGGAGGTGGCGGGG + Intergenic
1099945543 12:89239639-89239661 CTGGAGTGTGTGATGGGGGGTGG - Intergenic
1100138039 12:91579236-91579258 CAGGAGGGGTGGAGGTGGTGGGG - Intergenic
1100283081 12:93137205-93137227 CTGGGGTGGGGGAAGTGGGGAGG + Intergenic
1100354742 12:93818536-93818558 CTAGCGGGTGGGAGGTGGGGAGG + Intronic
1100383168 12:94081100-94081122 TTGGTGTGTGGGGGGGGGTGGGG - Intergenic
1100442204 12:94627511-94627533 ATGGGGTCTGAGAGGTGGTGGGG - Intronic
1101004815 12:100391372-100391394 GTGGGGTGGGGGAGGGGGTGGGG - Intronic
1101272478 12:103162274-103162296 CAGGAGTGGGGGTGGTGGAGAGG - Intronic
1101300712 12:103477357-103477379 CTGGAGGGTGGGTGGTAATGTGG + Intronic
1101861146 12:108483413-108483435 CTGGAGAGAGAGAGGTGGGGAGG + Intergenic
1102454995 12:113065651-113065673 CTGGAGTAGGGGAGGTGATGCGG + Intronic
1102532151 12:113554343-113554365 CTGGGGAGTGGGTGATGGTGGGG + Intergenic
1103360423 12:120350448-120350470 CTGGAGTGAAGGAAGGGGTGGGG - Intronic
1103415559 12:120739871-120739893 CTGGTGTTGGGCAGGTGGTGGGG + Exonic
1103947187 12:124533038-124533060 CTGGGGTGGGGGAGGAGGAGTGG - Intronic
1104492480 12:129206951-129206973 CTGGAGGGTGGGAAGGGGAGAGG + Intronic
1104796227 12:131521400-131521422 CTGGTCTCTGGGAGGTGGTGTGG + Intergenic
1104899041 12:132178336-132178358 CTGGAGTGCAGGGGGTGGGGGGG - Intergenic
1105070262 12:133230190-133230212 CTGGGTTCTGGGAGGTGCTGGGG - Intronic
1105211470 13:18259504-18259526 CAGGAGTGCCGGAGCTGGTGAGG - Intergenic
1105702037 13:22940962-22940984 CTGGCGTGTGGCAGGCTGTGGGG + Intergenic
1105866189 13:24461697-24461719 CAGGTGTGTGGGAGGTGCTGGGG + Intronic
1106017515 13:25883765-25883787 CAGCAGACTGGGAGGTGGTGAGG - Intronic
1106587269 13:31068423-31068445 ATGCAGTGTAGGGGGTGGTGGGG - Intergenic
1106626475 13:31425652-31425674 CTGGAGTGTGAGAGAAGGAGGGG + Intergenic
1107055928 13:36103318-36103340 CTTGAGCCTGGGAGGTGGAGAGG + Intronic
1107107800 13:36665379-36665401 CTGGAGTGTGCGTGCTGTTGCGG + Intergenic
1107406944 13:40123276-40123298 CTGGAGTGAGGATGGGGGTGAGG - Intergenic
1107443583 13:40449852-40449874 CTGGAGTGGAAGGGGTGGTGAGG + Intergenic
1107552578 13:41491077-41491099 GTGGAGTGGGGGAGGGGGCGCGG + Intergenic
1107823925 13:44310626-44310648 CTGGAGTGAGGGATCTGGGGAGG + Intergenic
1108527700 13:51299956-51299978 GTGGAGTCTGGAAGGTGCTGTGG + Intergenic
1110349184 13:74487239-74487261 CAGGATTGGGGGTGGTGGTGAGG + Intergenic
1111788972 13:92828243-92828265 CAGGTGTGTGGGGTGTGGTGGGG - Intronic
1112725509 13:102299616-102299638 CTGGACAGCGGGAGGTGGAGAGG + Intronic
1113134807 13:107077633-107077655 CTGCCGTGAGGGAGGTGGTGTGG - Intergenic
1113527377 13:110991720-110991742 CTGGAGGGTGGGAGCTGGGATGG + Intergenic
1113713182 13:112484352-112484374 CTGGAGGGTGGGAGCTGGGATGG - Intergenic
1113823354 13:113231438-113231460 GTGGGGAGTGGGAGGTGGGGAGG + Intronic
1114093200 14:19305964-19305986 CAGGAGTGTGGATGGGGGTGGGG - Intergenic
1114269974 14:21094554-21094576 CTGGAGTGAGGGACGGGGGGCGG + Intronic
1114554066 14:23551459-23551481 CTGGAGGGAGGGAGGAGGAGGGG - Exonic
1114643316 14:24239286-24239308 CTGCAGAGTGGGTGGTGGTAGGG + Intergenic
1114666225 14:24378579-24378601 CTGGAGTGAGGGTGGAGGTGAGG + Exonic
1114686064 14:24532930-24532952 CTGGATTGTGTGAGGTTGAGAGG + Intergenic
1114773092 14:25451243-25451265 CCTGAAAGTGGGAGGTGGTGAGG - Intergenic
1115016039 14:28615679-28615701 GTGGAGGGTGGGAGGAGGAGGGG - Intergenic
1116858106 14:49971649-49971671 CTCGTGTGTGTGTGGTGGTGGGG + Intergenic
1116923851 14:50612262-50612284 CTGGAGGGTGGCAGGAGGAGGGG + Intronic
1116964220 14:50997953-50997975 CAGGAATGTGGGCAGTGGTGGGG + Intronic
1117516027 14:56502139-56502161 CTGGGGTGTGGAGGGTGGAGGGG - Intronic
1118080032 14:62348079-62348101 CTGGAGTGCAAGAGATGGTGAGG + Intergenic
1118811255 14:69275776-69275798 CTTGAGTCTGGGAGGTCATGAGG + Intronic
1118854645 14:69611657-69611679 CGGGAGGGAGGGAGGAGGTGGGG - Exonic
1120538786 14:85730002-85730024 ATGGATTGTGGGAGATGGAGAGG - Intergenic
1121331521 14:93052696-93052718 TTGGAGGGAGGGTGGTGGTGCGG - Intronic
1121415894 14:93779186-93779208 GAGGAGTCTGGGAGGTGGCGGGG + Exonic
1121503752 14:94460781-94460803 CTGCAGTGTGGGGAGTGGTTAGG - Intergenic
1121589555 14:95092887-95092909 CTGGAGCGTGGCAGGCTGTGAGG - Intronic
1121623184 14:95364416-95364438 CTGGGGTGTGGGGGGAGGAGGGG + Intergenic
1121833159 14:97069182-97069204 CTTGGGTGTGGGTGGAGGTGGGG + Intergenic
1122020361 14:98833250-98833272 CTGGAGTGTGGGAGTGGAAGGGG - Intergenic
1122154001 14:99739468-99739490 CTGGAGGCTGGGAGGTGACGTGG + Intronic
1122770033 14:104093766-104093788 TTGGAGTGTGGGCGGGGCTGTGG + Intronic
1122770039 14:104093785-104093807 GTGGAGTGTGGGTGGGGCTGTGG + Intronic
1122770049 14:104093823-104093845 GTGGAGTGTGGGTGGGGCTGTGG + Intronic
1122815640 14:104310787-104310809 CAGGAGTGTGGTGGGTGGGGTGG + Intergenic
1122885224 14:104707730-104707752 CGGGAGTGGTGGAGGTGGTGGGG - Exonic
1123476489 15:20595155-20595177 GTGGAGTGTGGGAGGGGTGGAGG + Intergenic
1123641522 15:22405209-22405231 GTGGAGTGTGGGAGGGGTGGAGG - Intergenic
1123849746 15:24342860-24342882 GCGGAGTGGGGGTGGTGGTGGGG - Intergenic
1124630885 15:31336381-31336403 CTGGCATGTGGGAGGTGGTCAGG + Intronic
1124808380 15:32908755-32908777 TTGGGGTGTGGGTGGGGGTGGGG + Intronic
1124962327 15:34408375-34408397 ATGGTGTGTGGTATGTGGTGTGG - Intronic
1124978951 15:34554597-34554619 ATGGTGTGTGGTATGTGGTGTGG - Intronic
1125016986 15:34946743-34946765 CGGGAGGGAGGGAGGTGGGGGGG + Intronic
1125044879 15:35233738-35233760 CTGGAGTGTGGAGAGTGATGAGG - Intronic
1125447633 15:39775012-39775034 TTGCAGTGGGGGAGGTGGAGGGG + Intronic
1125507964 15:40277924-40277946 CAGGACTGAGGGAGATGGTGTGG + Intergenic
1125551127 15:40545645-40545667 TTGGCCTGTAGGAGGTGGTGTGG + Intronic
1125593786 15:40872035-40872057 CTGGACTGTGGGGGTAGGTGTGG - Intergenic
1125673198 15:41487983-41488005 GTGGTGTGTGGTATGTGGTGTGG - Intergenic
1125743081 15:41980940-41980962 CTGGTGTGTGGGAGCGGGTGGGG + Intergenic
1126757125 15:51935734-51935756 ATGGAGTTTAGGAGTTGGTGTGG - Intronic
1126917058 15:53477548-53477570 CTGGAGTGTGGTAGTTGTGGGGG + Intergenic
1127139311 15:55957968-55957990 GTGGAGTGGGGGAAGGGGTGAGG + Intronic
1127396386 15:58546935-58546957 TTGGAGTGGGGGAGGTGGGAGGG - Intronic
1127473779 15:59313501-59313523 ATGGAGTGTTGGAGGTGGGGCGG - Intronic
1127702362 15:61513819-61513841 TGGGAGGGTGGGAGGGGGTGAGG - Intergenic
1127785109 15:62348930-62348952 CAGGAGTTAGGGATGTGGTGAGG - Intergenic
1127995200 15:64149932-64149954 CTGGACAGTGGGAGTTGGGGAGG + Intergenic
1128135507 15:65260327-65260349 CTGCAGTGTGGGAGTAAGTGTGG - Intronic
1128565839 15:68699991-68700013 CTGCAGCCTGGGAGGGGGTGGGG + Intronic
1128666886 15:69544874-69544896 CTGCTGTGTGGGAGTTGGCGAGG + Intergenic
1128746087 15:70115097-70115119 CTGGAGAGTGGTAGGTGGGATGG + Intergenic
1129187847 15:73921376-73921398 CTGGAGAAGGGGAGGTGGTGTGG - Intergenic
1129327491 15:74808782-74808804 CTGCAGTCTGGGAGACGGTGAGG + Intergenic
1129587886 15:76887004-76887026 ATGGAGTGTGGGAGGAGGGAGGG + Intronic
1129740380 15:77986965-77986987 CTGGAGCGAGGCAAGTGGTGTGG + Intronic
1129845372 15:78765632-78765654 CTGGAGCGAGGCAAGTGGTGTGG - Exonic
1129892608 15:79081580-79081602 CTGGGGTGTGGGGGGTGATTAGG - Intronic
1130200930 15:81826250-81826272 CAGGAGTGGGTGAGGTGGGGTGG + Intergenic
1130256476 15:82328227-82328249 CTGGAGCGAGGCAAGTGGTGTGG + Intergenic
1130598476 15:85261761-85261783 CTGGAGCGAGGCAAGTGGTGTGG - Intergenic
1130923258 15:88366602-88366624 CAGGAGTCTGGGTGGGGGTGGGG - Intergenic
1131068418 15:89448897-89448919 CTGGAATGCGGGTGGGGGTGGGG - Intergenic
1131400261 15:92119650-92119672 CTGGAGGGTGGGAAGAGGAGGGG + Intronic
1131535374 15:93232848-93232870 CTGAATTTTGGGGGGTGGTGGGG + Intergenic
1132638179 16:963696-963718 CTGGAGTTTGCGTTGTGGTGAGG - Intronic
1132715058 16:1286026-1286048 CTGGACTGTGGGAGCAGCTGGGG - Intergenic
1132730574 16:1359348-1359370 CTTGAGCCTGGGAGGTGGAGAGG - Intronic
1132873320 16:2125001-2125023 CTGCAGTGTGGGCGCTGGAGAGG + Intronic
1133020786 16:2966114-2966136 CGGGTGGGAGGGAGGTGGTGGGG - Intronic
1133277022 16:4645145-4645167 CGGGGGTGGGGGTGGTGGTGGGG + Intronic
1133737874 16:8629541-8629563 CTGGAGTGTGGCAGAGGGAGAGG + Intronic
1134191223 16:12122510-12122532 CTGGAGTGAGGGAGGGGGCCAGG + Intronic
1134208091 16:12253825-12253847 CTGGAGTGTGGGAGCAGGGGTGG + Intronic
1134423710 16:14118216-14118238 CTTGAGCCTGGGAGGTGGAGGGG - Intronic
1134837547 16:17374826-17374848 GTTATGTGTGGGAGGTGGTGGGG - Intronic
1135113859 16:19710001-19710023 CTGGAGAGTGTGAGGTTGTCAGG - Intronic
1135156210 16:20055089-20055111 GTGGAGGGTGGGAGGAGGTAGGG - Intronic
1136512662 16:30748674-30748696 CTGGGGGGTGGGGGGGGGTGGGG - Intronic
1137566781 16:49538212-49538234 CTGGAGAGTTGGAGGCTGTGTGG - Intronic
1137687110 16:50393725-50393747 CTGGAGGGGAGGGGGTGGTGAGG + Intergenic
1137722876 16:50638119-50638141 CTGAAGTGTGGCAGGAGGAGGGG + Exonic
1138283100 16:55786916-55786938 CAGGTGTGCGGGAGGTGGTCTGG + Intergenic
1138350195 16:56342217-56342239 CTGGAGTGGGGAAGGAGGAGGGG + Intronic
1138437271 16:57010092-57010114 CTGAAGTGGGGAAGGTGGTCTGG + Intronic
1138506902 16:57482971-57482993 CTGGGGTATGGGACGGGGTGGGG - Intronic
1138515420 16:57533270-57533292 CGGGTGTGTGGGAAGGGGTGGGG + Intronic
1138519562 16:57563344-57563366 CTGGACTGTGGGGTGTGGGGAGG - Intronic
1138607889 16:58100230-58100252 CTGGACTTTGGGTGGTGGTGTGG - Intergenic
1139474826 16:67197922-67197944 CTGGAAGGTGGGAGTGGGTGTGG + Intronic
1139564641 16:67766435-67766457 CTGGTGGGTGGGAGGTGTTTGGG + Intronic
1139582494 16:67881612-67881634 CTGGTGTGTGGGAATAGGTGGGG + Intronic
1140481210 16:75263906-75263928 GGGCAGTGTGTGAGGTGGTGGGG - Intronic
1140732723 16:77871221-77871243 GTGGAGGGTGGGAGGAGGTAGGG - Intronic
1141746023 16:85926737-85926759 CTGGAATGGGGCAGGTGGGGTGG + Intergenic
1142155165 16:88529676-88529698 CTGGAGGGCGGCAGGTGGTCTGG + Intronic
1142547378 17:714481-714503 GTGGAGGTGGGGAGGTGGTGCGG - Intronic
1142592213 17:1011297-1011319 CTGGAGTGGAGGACGGGGTGGGG - Intronic
1142686680 17:1581134-1581156 CAGGAATGTGGGTGGTGGGGGGG + Intronic
1143149484 17:4798728-4798750 CTGGATTGTGGTTGGTGTTGGGG + Intergenic
1143199053 17:5099365-5099387 CTGGAATGTGGATGGGGGTGCGG + Intergenic
1143636819 17:8169279-8169301 ATAGAGTGTTGGAGGGGGTGTGG - Intergenic
1143642222 17:8205519-8205541 CTGGAGTGGGGGTGGGGTTGGGG + Intronic
1144461337 17:15460886-15460908 CTGGAGGGTGGTTGGCGGTGGGG - Intronic
1144566667 17:16365133-16365155 ATGTAGTTTGGGAGGTGGTGGGG - Intergenic
1144787201 17:17838475-17838497 CTAGAGTGTTGGTGGGGGTGGGG - Intergenic
1145775474 17:27524851-27524873 CTGGAGTGGCAGTGGTGGTGTGG + Intronic
1145911339 17:28545038-28545060 TTGGAGAGAGGGAGGAGGTGAGG - Intronic
1145911900 17:28547968-28547990 CTGGGCTATGGGTGGTGGTGGGG - Intronic
1146272461 17:31493343-31493365 CTGGAGTGTGGGAGAGTGGGCGG + Intronic
1146829289 17:36054186-36054208 AGGGAGTGTGGGAGGGGGTGAGG + Intergenic
1147263984 17:39224346-39224368 CTGAAGTCTGGGAGGTGGCAGGG + Intronic
1147311044 17:39596412-39596434 CTGGTATGTGGGAGGGGGTGGGG + Intergenic
1147446126 17:40476218-40476240 CTGGAGGCTGGGTGGGGGTGGGG + Exonic
1147667909 17:42160247-42160269 CTGGAGGCTGGGTGGTGGTCTGG + Exonic
1147897072 17:43757913-43757935 CTGGTGTGTGGGGGGGTGTGGGG - Intronic
1147999744 17:44380720-44380742 CTCCAGTGGGGGAGGTGGTGTGG - Intronic
1148151490 17:45398932-45398954 CTGGAGTGTGGGAGGTGGTGGGG - Intronic
1148496148 17:48054593-48054615 CTGCGGGGTGGGAGGGGGTGGGG + Intronic
1148667090 17:49382902-49382924 CTAGTGAGTGGGAGGTGATGGGG + Intronic
1148859426 17:50596357-50596379 CTGGAGAGGCAGAGGTGGTGGGG + Intronic
1148912412 17:50949928-50949950 CTGGGGTGTGGGAGGCTGAGAGG + Intergenic
1149571536 17:57675663-57675685 CTGGAGCCCGGGAGGTGGTGTGG + Intronic
1149573947 17:57697976-57697998 CGTGAGTGTGGGAGGCAGTGAGG - Intergenic
1150065532 17:62105699-62105721 CTGGGATGCGGGAGGTGGAGAGG + Intergenic
1150649215 17:66998990-66999012 ATGTAGTTTGAGAGGTGGTGGGG + Intronic
1150650668 17:67008102-67008124 CTGCTGTGTGTGAGGTGCTGGGG - Intronic
1151009685 17:70480297-70480319 TTGGAGTGAGGAAGGTGCTGTGG + Intergenic
1151013770 17:70531118-70531140 GTGGAGGGTGGGGGGTGGAGGGG + Intergenic
1151129665 17:71883273-71883295 CTGGAGTGTGTGAGGGTGAGAGG + Intergenic
1151156172 17:72124121-72124143 CTGTAGTGTGGGAGGTTGAAGGG - Exonic
1151398507 17:73840642-73840664 CTGGGGTGGGGGTGGAGGTGTGG + Intergenic
1151401508 17:73858741-73858763 CCGGAGGGTGGGGGGTGTTGGGG + Intergenic
1151579788 17:74971581-74971603 CTGGAGAGCAGGAGGTGGGGGGG + Intronic
1151662280 17:75525372-75525394 CTGGAGTCTGGGAGGCGGCCCGG + Intronic
1151682287 17:75628521-75628543 CTGGAGAGAGGCAGCTGGTGCGG - Intronic
1151860818 17:76760192-76760214 CTGGGGTGGGGGTGGTGGCGGGG + Intronic
1151872323 17:76844703-76844725 CTGGAGTGGGGGATGTGGTCAGG + Intergenic
1151988077 17:77556764-77556786 CTGGAGCTGGGGAGGAGGTGAGG - Intergenic
1152045947 17:77935759-77935781 CGGGGGAGGGGGAGGTGGTGGGG + Intergenic
1152110726 17:78356278-78356300 CTGTGGTGGGGGAGGGGGTGGGG + Intergenic
1152162037 17:78674916-78674938 CTGGAGTGAGGGGGGTGGCCGGG - Exonic
1152279025 17:79374334-79374356 CTGGTGTGTGGGTGGTGGTGCGG + Intronic
1152496645 17:80677541-80677563 CTGGAGTCTGGTGGGAGGTGAGG - Intronic
1152557812 17:81063197-81063219 CTGGAGCGTATGAGGGGGTGAGG + Intronic
1152601195 17:81263123-81263145 CTGGGAGGTGGCAGGTGGTGGGG - Intronic
1152790130 17:82274191-82274213 CTGGAGGGAGGCAGGTGGTCTGG - Intergenic
1152856308 17:82666582-82666604 CTGGTGTCTGGGGGGTGATGGGG - Intronic
1153046518 18:860319-860341 CGGGGGTGGGGGTGGTGGTGGGG + Intergenic
1155826976 18:30457656-30457678 TTGGGATGTGGGAGGTGTTGAGG + Intergenic
1155987645 18:32247221-32247243 GGGGAGAGTGGGAGGGGGTGAGG - Intronic
1156684773 18:39631594-39631616 GTGGGGTGTGTGAGGTGGAGGGG - Intergenic
1157006240 18:43588441-43588463 CTGGATTGTGGGGAGTGGTAGGG + Intergenic
1157194056 18:45606062-45606084 CTGGAGGCGGGGAGGTGATGAGG + Intronic
1157326081 18:46669640-46669662 TTGCAGTGTGGGTGATGGTGTGG - Intronic
1157328120 18:46683735-46683757 ATTGAGTGCGGGAGGGGGTGGGG + Intronic
1157369520 18:47097869-47097891 GTGGAGGGTGGGAGGAGGAGAGG - Intronic
1157374879 18:47153361-47153383 AGGGAGGGTGGGAGGGGGTGAGG - Intronic
1157408150 18:47440996-47441018 CAGGAGTGTGTGGGGTGGGGAGG + Intergenic
1157591821 18:48840867-48840889 CTGGGGTGGGGGTGGGGGTGGGG - Intronic
1157684204 18:49629618-49629640 ATGCAGGGTGGGAGGTGGTGGGG + Intergenic
1157705315 18:49800257-49800279 CGGGAGGGAGGGAGGTGGGGGGG + Intronic
1157825121 18:50805551-50805573 CTGGAGTGTGGCATGTGGGTGGG + Intronic
1158123685 18:54078808-54078830 TAGGAGGGTGGGAGGGGGTGAGG - Intergenic
1158344624 18:56503682-56503704 ATGGAGTGTGTGGGGGGGTGGGG + Intergenic
1158492992 18:57927378-57927400 TGGGAGGGTGGGAGGGGGTGAGG + Intergenic
1158519177 18:58156596-58156618 GTGGGGCGTGGGAGGCGGTGGGG - Intronic
1158594160 18:58801916-58801938 CTGAAGGGTGAGAGGTGGGGAGG - Intergenic
1159002823 18:62988467-62988489 CTGGAGGTTGGCGGGTGGTGTGG - Intergenic
1159056539 18:63471070-63471092 CTGGGGTGTGGGTGGCGGTAGGG + Intergenic
1159856761 18:73598291-73598313 CCGTATTGTGGGATGTGGTGTGG + Intergenic
1160436785 18:78857947-78857969 CTGGAGAGGAGGAGGAGGTGTGG - Intergenic
1160471440 18:79137949-79137971 CTGGAATGTAGTAGGTGTTGAGG + Intronic
1160534886 18:79586489-79586511 CTGGAGTGGGGGAAGGCGTGTGG + Intergenic
1160552842 18:79706069-79706091 GAGGGGCGTGGGAGGTGGTGAGG + Intronic
1160921018 19:1520628-1520650 CTGGGATGTGAGAGGTGCTGGGG + Intergenic
1160971549 19:1769923-1769945 TTGGAGCCTGGGAGGTGGGGTGG + Intronic
1161091711 19:2363528-2363550 CGAGAGTGTGGGAGGGAGTGAGG + Intergenic
1161118478 19:2512433-2512455 CTGGGGTCCGGGAGATGGTGGGG + Exonic
1161223938 19:3133602-3133624 CTGGTGTCTGGGAGGAGGTGGGG + Intergenic
1161285055 19:3464421-3464443 CTGGGGTGGGGGTGGAGGTGTGG - Intronic
1161544815 19:4874030-4874052 CTGGAGCGTAGAATGTGGTGGGG + Intergenic
1161612412 19:5250644-5250666 CGGGAGGGTGGGCGGTGGGGTGG + Intronic
1161706464 19:5824393-5824415 CAGTGGAGTGGGAGGTGGTGGGG + Intronic
1162080887 19:8217020-8217042 CTGGAGTCTGGAAGGAGCTGGGG + Intronic
1162413646 19:10520999-10521021 GTGGGGTGTGGGAGGAGGTATGG - Intergenic
1162757082 19:12866882-12866904 CGGGAGTCTGGAAGGTGGTAAGG + Intronic
1162964105 19:14147919-14147941 CTGGGGCGTGGGAGGTGGGGAGG + Exonic
1163110778 19:15160007-15160029 GTGAAGTGAGGGAGGTGGGGTGG + Exonic
1163167318 19:15507371-15507393 TTGGAGTGTGAGAGGTGTGGAGG - Intergenic
1163446793 19:17351692-17351714 CTGGAGGAGGGGAGGTGCTGGGG + Exonic
1163676581 19:18658368-18658390 AGGCAGTGTGGGAGGTGGTGTGG - Intronic
1164668685 19:30060978-30061000 CTGGGGTGGGGGACGTGATGGGG - Intergenic
1164707298 19:30329395-30329417 CTGGGGAATGGGAGGTGGGGAGG + Intronic
1164725841 19:30465122-30465144 AGGGAGAGTGGGAGGTGATGGGG - Intronic
1164825831 19:31284324-31284346 CTGGAGTCAGGGAGTTGGTTGGG - Intronic
1165069991 19:33249465-33249487 CTGGAGGGAAGGAGGAGGTGAGG + Intergenic
1165149904 19:33754065-33754087 ATGGATGGTGGGAGATGGTGTGG - Intronic
1165303649 19:34989668-34989690 CTGCAGTGATGGAGGGGGTGGGG - Intergenic
1165712661 19:38023234-38023256 CTGGAGAGGGTGAGGCGGTGGGG + Intronic
1165772097 19:38385912-38385934 CTGCAGTGTGGGCGGCGGTGTGG + Exonic
1166361040 19:42253224-42253246 CTGGAGTGGGGGAGGTGGTGGGG - Intronic
1166380856 19:42354513-42354535 CTGGGGTCTGGGAGGAGGAGGGG - Intronic
1166745844 19:45141540-45141562 CTTGAGTGTGGGCTGTTGTGGGG + Intronic
1166930110 19:46297166-46297188 CTGGATTGTTGGGGGGGGTGGGG + Intronic
1167114081 19:47478892-47478914 CAGGAAGGTGGGAGGCGGTGTGG + Intronic
1167579270 19:50332351-50332373 CAGAAGTGTGGGAGAAGGTGGGG + Intronic
1167757400 19:51421409-51421431 CTGGAGAAGGGGACGTGGTGAGG - Intergenic
1168064456 19:53911035-53911057 CTGGATTGGTGGTGGTGGTGGGG + Intronic
1168287079 19:55340382-55340404 CTGGAGGGTGAGAGGAGGTCGGG - Intronic
1168492671 19:56823600-56823622 ATGGACTGAGTGAGGTGGTGAGG + Exonic
925017622 2:543738-543760 CTGGAGGGTGGGAGGCAGGGAGG + Intergenic
925017636 2:543776-543798 CTGGAGGGTGGGAGGCAGGGAGG + Intergenic
925232861 2:2251485-2251507 CTGGAGTGGGGCAGGAGGTGGGG - Intronic
925288466 2:2730838-2730860 CAGGAGTGTGCCTGGTGGTGCGG - Intergenic
925357363 2:3251464-3251486 GTGGAGTGGGGGTGGTTGTGGGG - Intronic
925912772 2:8583987-8584009 CTGGATTGTGGGAGGAGCGGTGG - Intergenic
926093314 2:10064469-10064491 CTGCAGAGGGGGAGGTAGTGAGG - Intronic
926212437 2:10880683-10880705 CGGGAGCCTGTGAGGTGGTGCGG - Intergenic
926365515 2:12129649-12129671 AAGGAGTGTTGGAAGTGGTGAGG - Intergenic
926872422 2:17437075-17437097 TTGGGGAGTGGGAGGTGGGGTGG + Intergenic
926890326 2:17633993-17634015 TTGGAGTGTCTGAGGAGGTGAGG + Intronic
927140912 2:20130208-20130230 CTGGGGTGGGAGAGGTGGAGTGG - Intergenic
927194740 2:20539646-20539668 ATGGAGTGTGGGAGAAGGGGTGG - Intergenic
927651233 2:24914903-24914925 AGGGAGTGTGGGATGGGGTGGGG - Intronic
927982816 2:27385183-27385205 CTTGGGAGTGGGAGGTTGTGGGG - Intronic
928275574 2:29897494-29897516 CATCAGAGTGGGAGGTGGTGGGG + Intronic
928289250 2:30023272-30023294 CTGGAGTGTATGAGCTGCTGGGG + Intergenic
928326641 2:30324399-30324421 GTGCAGTGTGGGAGGCAGTGTGG + Intergenic
928399988 2:30970873-30970895 GTGGAGTGGGGGCGGTTGTGAGG - Intronic
929063420 2:37947187-37947209 CAGGAGGGTGGGAGGAGGTGAGG - Intronic
929166974 2:38892364-38892386 ATGGAGTGTGTGAGTAGGTGGGG + Intronic
929511629 2:42569187-42569209 CTGGGGTGGGGGTGGGGGTGGGG + Intronic
929582051 2:43087583-43087605 CTGGAGTGTGGGAGGTGCCATGG - Intergenic
930035623 2:47083570-47083592 TGGGAGGCTGGGAGGTGGTGGGG - Intronic
930120163 2:47754170-47754192 CTGGAGTGTGGGAGTGGGAGGGG - Intronic
930610883 2:53542092-53542114 GGGGAGGTTGGGAGGTGGTGAGG - Intronic
930718922 2:54620145-54620167 CGGGAATGTGGTAGGTGGAGTGG + Intronic
931652451 2:64480772-64480794 CTGGGGTGTGGGTTTTGGTGTGG - Intergenic
931743679 2:65272916-65272938 CTGGTGGGTGGGAGGAGTTGAGG - Intergenic
931921679 2:67023801-67023823 GTGGAGGGTGGGAGGAGGTAAGG + Intergenic
932053210 2:68419208-68419230 CTGGGGTGAGGGTGGGGGTGAGG + Intergenic
932369771 2:71177450-71177472 CTGGTCTGTGGCAGGTGGTCTGG - Intergenic
932415961 2:71574078-71574100 CACTAGTGTGGGAGCTGGTGGGG + Intronic
932430985 2:71673377-71673399 CTGGTCTGAGGGAGGTGGGGTGG + Intronic
932479864 2:72032686-72032708 CTGGAATGTGGGAGTGAGTGTGG - Intergenic
932815745 2:74860197-74860219 TAGGAGGGTGGGGGGTGGTGTGG + Intronic
932864602 2:75328242-75328264 CTGCTGTGTGGTAGGTGGGGGGG + Intergenic
933754845 2:85630107-85630129 AAAGAGTGTGGGGGGTGGTGAGG - Intronic
933773358 2:85757372-85757394 CTGGATTCGGGGAGGGGGTGCGG - Intronic
933802942 2:85977459-85977481 CTGGAGTGTGGGAACTACTGAGG - Intergenic
934616510 2:95774657-95774679 GTGGTTTGTGGGAGGTGTTGTGG + Intergenic
934644383 2:96049903-96049925 GTGGTTTGTGGGAGGTGTTGTGG - Intergenic
934711968 2:96522348-96522370 CTGGAGGGTGGGAGCGGGGGAGG - Intergenic
934837799 2:97605993-97606015 GTGGTTTGTGGGAGGTGTTGTGG - Intergenic
934942754 2:98514268-98514290 CTGGAGTTAGAGAGGGGGTGTGG + Intronic
936058563 2:109279821-109279843 CAGGAGTGTGGGGGCTGGTGGGG + Intronic
936259293 2:110944492-110944514 CTTGAGGATGGGAGGAGGTGAGG - Intronic
936278453 2:111119679-111119701 CGGGGGTGTGGGAGGTGGATCGG - Intronic
937148076 2:119664379-119664401 CTGGAAGGTGGGGGGTGGGGAGG - Intergenic
937201984 2:120209752-120209774 CTGCAGAGTGGGAGATGGGGTGG + Intergenic
937267569 2:120626149-120626171 GAGAAATGTGGGAGGTGGTGAGG - Intergenic
937351813 2:121170303-121170325 CTGTTTTGGGGGAGGTGGTGAGG + Intergenic
937686586 2:124704776-124704798 CTGGGGTGTAGGGGGAGGTGAGG - Intronic
938222812 2:129586614-129586636 ATGTAGTGTAGGAGGGGGTGAGG - Intergenic
938268001 2:129943109-129943131 AGGGAGTGTGGGAGGGGGTGAGG - Intergenic
938310570 2:130286034-130286056 CTGGAGGGTGGGGGGAGGGGTGG + Intergenic
938312327 2:130301450-130301472 CTGCAGTGGTGGGGGTGGTGTGG + Intergenic
938377172 2:130815532-130815554 CTGCTGTGTGGGAGGTGGTGAGG + Intergenic
940202366 2:151165811-151165833 CTGGGGTGGGGGAGGTGGTCAGG - Intergenic
940436752 2:153665482-153665504 CTAGATAGGGGGAGGTGGTGGGG - Intergenic
940980373 2:159994933-159994955 CTGTGGTGTGGGATGTGGGGTGG + Intronic
941752096 2:169144380-169144402 GTGGAGTGGGGGTGGGGGTGGGG - Intronic
942245501 2:174004159-174004181 GAGGAGGGTGGGGGGTGGTGAGG + Intergenic
942532724 2:176929354-176929376 GTGGAGGCTGGGAGGAGGTGAGG - Intergenic
942663736 2:178293767-178293789 GTGGAGGGTGGGGGGAGGTGAGG - Intronic
943029998 2:182674593-182674615 CAGGAGTGGGTGGGGTGGTGGGG - Intergenic
943051271 2:182916091-182916113 TTGGAGTGGGGGAGGGGGAGAGG - Intronic
943445271 2:187977605-187977627 CTGGGCCGTGGCAGGTGGTGGGG + Intergenic
943910070 2:193552778-193552800 CAGGAGAGTGGGAGGGGATGAGG + Intergenic
944168024 2:196743548-196743570 GTGGGGGGTGGGAGGGGGTGGGG - Intronic
944168035 2:196743565-196743587 ATGGAGTGGGGGTGGGGGTGGGG - Intronic
944223171 2:197322854-197322876 GTGGAGTGGCGGAGGAGGTGAGG - Intergenic
944233132 2:197415920-197415942 CTGGGGTATGGGGGGTGGTGGGG - Intronic
944255384 2:197618992-197619014 CGGGAGGGAGGGAGGTGGGGGGG + Intronic
945259791 2:207832790-207832812 CTGGTGTGGGGGAGGTGCAGGGG - Intronic
945714748 2:213344521-213344543 GTGGGGTGTGGGAAGTGGAGAGG - Intronic
945957228 2:216097820-216097842 GTGGAGGGTGGAAGGTGGTGGGG + Intronic
946039746 2:216773452-216773474 CTGGAGCATGTCAGGTGGTGAGG + Intergenic
946106806 2:217377851-217377873 CTGGAGAGTGGGAGGAGGGGAGG - Intronic
947000511 2:225450211-225450233 CTGGAGTGTGTGAGGGTGTGAGG + Intronic
947023292 2:225708234-225708256 CTGGAGTCTGGGAGGAGGCAGGG - Intergenic
948138856 2:235658515-235658537 CAAGAGTCTGGGAGGAGGTGTGG + Intronic
948248143 2:236503742-236503764 GTCCAGTGTGGGAGGGGGTGTGG - Intronic
948483181 2:238263161-238263183 CGGGGGTGGGGGAGGGGGTGGGG - Intronic
948563874 2:238871323-238871345 GTGGTGTGTGGGGGGTTGTGTGG - Intronic
948695657 2:239732023-239732045 GTGGAGGGTGGGAGGTGGAGGGG - Intergenic
948768033 2:240233458-240233480 TTGAAGTGGGGGAGGTGCTGTGG - Intergenic
948985601 2:241520790-241520812 CAGGACTGTGGGAGGAAGTGGGG - Intergenic
1168871775 20:1135269-1135291 CTGGTGTGTGGGTGGTGTGGAGG - Exonic
1168913645 20:1469292-1469314 CTGGAGGTTGGGGGCTGGTGTGG - Intronic
1169405501 20:5317928-5317950 CTTGAGTGGGGGAGATGATGGGG + Intergenic
1170363983 20:15580355-15580377 ATGGAGTGTGGGAGTGGGAGTGG - Intronic
1171289347 20:23972497-23972519 ATGGAGGGAGGGAGGTGGAGAGG + Intergenic
1171935585 20:31272323-31272345 CTGGGGTGTGGGATGTTGTGTGG - Intergenic
1172100441 20:32481936-32481958 TTGGTGTGTGTGAGTTGGTGGGG + Intronic
1172502303 20:35436278-35436300 CTGAGGTGGGGGAGGTGGTCTGG - Intronic
1172630340 20:36374261-36374283 CTGGAATGTGAGAGGTGCTAAGG + Intronic
1172872923 20:38147047-38147069 CTGGTGTGCGGCAGATGGTGGGG + Intronic
1172944082 20:38674528-38674550 CTGGTGTGTGGGTGAGGGTGTGG - Intergenic
1173560560 20:44002367-44002389 CTGGAGTTTCAGAGATGGTGGGG - Intronic
1173818910 20:46008414-46008436 CTGGAGTGTGGGGAGGGGTTTGG + Intergenic
1173869065 20:46330468-46330490 CTGGCGGGTGTGGGGTGGTGGGG + Intergenic
1173966341 20:47115610-47115632 CTGAAATGAAGGAGGTGGTGGGG - Intronic
1174299087 20:49568766-49568788 CTGGGGTGGGGGATGGGGTGAGG - Intergenic
1174324961 20:49771740-49771762 CTTGAGTGGGGGTGGGGGTGGGG + Intergenic
1174722843 20:52832021-52832043 CTGGTGTGTGGGAGGATGTAAGG - Intergenic
1174984336 20:55432966-55432988 CTGGAGTCTGGGAGATGGAGAGG + Intergenic
1175013823 20:55766650-55766672 AGGGAGTGGGGGTGGTGGTGGGG + Intergenic
1175136532 20:56828498-56828520 CTCCAGTGTGGGAGGTGGGTGGG + Intergenic
1175525895 20:59633034-59633056 GAGGAGTGTGGGAGTTGATGGGG + Intronic
1175531666 20:59677344-59677366 TGGGAGTGTGGGAGTGGGTGAGG + Intronic
1175669068 20:60885824-60885846 ATCGTGTGTGGGGGGTGGTGGGG + Intergenic
1175758851 20:61547574-61547596 CTGGGGTGGGGGTGGGGGTGGGG + Intronic
1175934581 20:62509151-62509173 GTGGAGGGTGGAAGGTGGAGGGG - Intergenic
1175980833 20:62737857-62737879 CAGGGGTGTGGGGGGTGGGGAGG - Intronic
1176135933 20:63521972-63521994 GTGGGGGGTGGGAGGTGGGGAGG - Exonic
1177206754 21:18018712-18018734 CGGGAGTGTGGGAGAGGGTGTGG + Intronic
1177459478 21:21392088-21392110 GTGGAGGGTGGGAGGTGGAGAGG - Intronic
1177836261 21:26189172-26189194 CATGAGGGTGGAAGGTGGTGAGG + Intergenic
1178026974 21:28479158-28479180 GTAGAGGGTGGGAGGTGGTGAGG + Intergenic
1178581118 21:33839435-33839457 ATGGAGTGGGGGAAGAGGTGTGG + Intronic
1178663346 21:34524831-34524853 CTGGAGTGTGGCTGTCGGTGGGG + Intronic
1178824518 21:36004752-36004774 CAGCAGTGGGGGAGGAGGTGGGG + Intergenic
1179300236 21:40101768-40101790 TTTTACTGTGGGAGGTGGTGGGG + Intronic
1179481577 21:41681976-41681998 CAGGGGTGTGGGATGAGGTGAGG - Intergenic
1179626948 21:42654068-42654090 CTGGGGGGTGGGGGGTGGGGGGG + Intronic
1179810547 21:43866375-43866397 CTGGGGGCTGGGAGGTGGGGCGG + Intronic
1179948802 21:44698155-44698177 CTGGAATGTGGGAAGTGGTCTGG - Intronic
1180081614 21:45490041-45490063 GGGGAGTGGGGGAGGAGGTGTGG - Intronic
1180084187 21:45500358-45500380 GTGTAGTGTGTGAGGGGGTGGGG + Intronic
1180156867 21:45982196-45982218 CTGGCGAGGGGGAGCTGGTGCGG + Intronic
1180581632 22:16844544-16844566 CTGGAGTTTGGGAGGTGGGAGGG + Intergenic
1180764756 22:18339934-18339956 CAGGAGTGCCGGAGCTGGTGAGG + Intergenic
1180814273 22:18779750-18779772 CAGGAGTGCCGGAGCTGGTGAGG - Intergenic
1180857765 22:19059105-19059127 CTGGGGAGTGGTAGGTGATGAGG + Intronic
1180919994 22:19516672-19516694 CTGGAGGGTCGGGGGTGTTGGGG + Intronic
1180921227 22:19522671-19522693 CTGCGGTGTGGGAAGTGCTGGGG - Intergenic
1180934845 22:19618690-19618712 CTGGATTCTGGGAGGCAGTGTGG - Intergenic
1181200459 22:21214085-21214107 CAGGAGTGCCGGAGCTGGTGAGG - Intronic
1181359430 22:22323300-22323322 AGGGAGTGGGGGAGGGGGTGTGG + Intergenic
1181950557 22:26550725-26550747 GTGGTGGGTGGGAGTTGGTGTGG - Intronic
1181989899 22:26829472-26829494 CTGCAGGGTGGGTTGTGGTGGGG - Intergenic
1182079446 22:27518685-27518707 CTGGAGTAGGGGAGGGGATGGGG - Intergenic
1182279409 22:29209211-29209233 GTGGAGTGTGGGTGTAGGTGGGG + Intronic
1182286897 22:29254077-29254099 CTGGGCTGTGGCAGGTAGTGTGG + Intronic
1182345238 22:29658625-29658647 CTGGGGTGGGGGTGGGGGTGGGG - Intronic
1182355696 22:29721371-29721393 CTGGGCTGGGGGAGGTGCTGAGG + Intronic
1182446505 22:30392756-30392778 TTCGAGTGTGGGAAGTGGGGTGG + Intronic
1182885551 22:33771046-33771068 CGGGATTGTGGGAGATTGTGTGG - Intronic
1183062004 22:35341911-35341933 CTGGAGTTTGGCTGGTGGTAAGG + Intronic
1183173457 22:36204822-36204844 CTGGACTGCAGGAGGTGCTGGGG - Exonic
1183341516 22:37284327-37284349 CTGGAATGTTGGGGGTGGGGTGG + Intronic
1183406161 22:37631685-37631707 CTGGGGTGAGGGACTTGGTGAGG - Intronic
1183583890 22:38740948-38740970 CTGGAGAGTGGGTGGGGCTGGGG + Intronic
1183693492 22:39404911-39404933 CCGGAAGGTTGGAGGTGGTGGGG + Intronic
1184141100 22:42577796-42577818 CTAGAGTGAGGGGGGTGGTGGGG - Intergenic
1184265679 22:43344596-43344618 CTGGAGGGTGTGAGGGTGTGAGG - Intergenic
1184291850 22:43501590-43501612 CTGGAGTGTGTGTTGTGGGGAGG - Intronic
1184357844 22:43994452-43994474 CTGGCGTGTGGTGGGAGGTGGGG + Intronic
1184521225 22:44995400-44995422 CTGGAGTGTGTGGGGGGCTGGGG + Intronic
1184629285 22:45763236-45763258 CTGGAGAGAGTGAGGTGGTGAGG + Intronic
1184689039 22:46109141-46109163 CTGGAGTGTCGGTTCTGGTGCGG + Intronic
1184726521 22:46350545-46350567 CTGGAGAAGGGGAAGTGGTGCGG - Intronic
1184757228 22:46523907-46523929 CAGGACTGTGGGAGGGGCTGAGG - Intronic
1185095958 22:48806269-48806291 CTGGAGTCAGGGAGGTGGCTTGG - Intronic
1203226379 22_KI270731v1_random:80839-80861 CAGGAGTGCCGGAGCTGGTGAGG + Intergenic
1203264372 22_KI270734v1_random:5437-5459 CAGGAGTGCCGGAGCTGGTGAGG - Intergenic
949397073 3:3626097-3626119 TTGTAGGGTGGGAGGTGGGGTGG - Intergenic
950256423 3:11510448-11510470 CTGGGATGGGGGAGGGGGTGGGG - Intronic
950644932 3:14371436-14371458 CTGGAGTGTGGGTTAGGGTGAGG + Intergenic
950922036 3:16704511-16704533 TGGGAGTGTGGGAGTTTGTGTGG - Intergenic
950938337 3:16866471-16866493 CTGGAGGTGGGGAGGTGGGGGGG - Intronic
951342062 3:21500590-21500612 GTGAAGTGTGGGATGGGGTGAGG + Intronic
951981603 3:28573052-28573074 CTGGAGGATGAGAGGTGGTGGGG + Intergenic
953210478 3:40870747-40870769 CAGGAGAGTGGGAGGAGATGAGG - Intergenic
953369152 3:42372645-42372667 CTGGTGGGTGGGAGTTGGGGTGG - Intergenic
953881218 3:46692408-46692430 CTGGAGGGAGGGAGAGGGTGAGG - Intronic
953899641 3:46832820-46832842 CTGGTGAGTGGCAGGTGGTGAGG - Intronic
954036235 3:47852680-47852702 CTGGGGAGTGAGAGGAGGTGTGG + Exonic
954177932 3:48859072-48859094 CTGGTGAGTGGAAGGTAGTGGGG - Exonic
954224536 3:49173526-49173548 CTGGCGTGTGGGAAGGGTTGGGG - Intronic
954421347 3:50420617-50420639 GTGGAGAGTGGGAGGGTGTGGGG + Intronic
954445073 3:50542086-50542108 CAGGTGTGTGTGGGGTGGTGGGG + Intergenic
954710825 3:52504360-52504382 CTGGTGTGGGGGAGTTGGGGTGG - Intronic
954744196 3:52777828-52777850 CAGAAGTGGTGGAGGTGGTGGGG - Intronic
954997100 3:54891720-54891742 CAGAACTCTGGGAGGTGGTGCGG + Intronic
955066534 3:55537975-55537997 TAGGTGTGTGGGAGGCGGTGGGG + Intronic
956183004 3:66534767-66534789 CTCTAGTGTGGTAGGTGGAGAGG - Intergenic
956642167 3:71425479-71425501 CTGCAGTGTGGAGGGTGGGGAGG + Intronic
956887445 3:73574451-73574473 CTGGGGTGGGGGGGGTGGGGAGG + Intronic
956902470 3:73730838-73730860 CTGGGGTGTGGTAGATGGCGGGG + Intergenic
957655465 3:83068096-83068118 CTGGGGCGTGTCAGGTGGTGGGG + Intergenic
958735726 3:98007353-98007375 CGGGAGAGTAGCAGGTGGTGAGG + Intronic
959000692 3:100960876-100960898 CTGGAGGGTGGGGTGTTGTGAGG - Intronic
959703032 3:109316195-109316217 CTGGAGTGTGGGGGGAGGGGCGG - Intronic
959831114 3:110863737-110863759 CTTAAGGGTGGGAGATGGTGAGG - Intergenic
961462736 3:127062984-127063006 GTGGTGTGGGGGTGGTGGTGGGG + Intergenic
961775619 3:129282460-129282482 CTGGAGTGGGGACGGTGGTCTGG - Intronic
962402493 3:135072573-135072595 CAGGAGTGAGGCTGGTGGTGGGG - Intronic
963081666 3:141400918-141400940 CTGGAAGGTGGGAGGTGGTAGGG - Intronic
963117364 3:141742131-141742153 TTGGAGGGTGGAAGGTGGAGAGG - Intronic
963791419 3:149586743-149586765 CTGAAGGTTGGGATGTGGTGTGG - Intronic
964417756 3:156466138-156466160 TGGGACTGTGGGAGGGGGTGAGG - Intronic
964679572 3:159322641-159322663 CTGGAGTGTGAGGTGGGGTGGGG + Intronic
965010241 3:163078439-163078461 CTAGAGTTTGGGAAGTGTTGTGG + Intergenic
965318537 3:167222419-167222441 GTGGAGGGTAGGAGGTGGGGTGG + Intergenic
966391222 3:179454400-179454422 CTAGCGTGTGGGATGGGGTGAGG - Intergenic
966657315 3:182374148-182374170 GTGGAGGTTGGGAGGAGGTGAGG + Intergenic
967142290 3:186571014-186571036 CTGGGGGGTGGGAGGGGGTGGGG + Intronic
967548497 3:190761409-190761431 CTTGGGTGTGGGAGGAGATGGGG - Intergenic
968132424 3:196199295-196199317 AGGGAGTTTGGGAGGGGGTGAGG - Intronic
968566678 4:1317001-1317023 CTGGAGTGTGGGGGCCGGGGTGG - Intronic
968566727 4:1317145-1317167 CTGGAGTGTGGGGGCTGGGGTGG - Intronic
968566739 4:1317182-1317204 CTGGAGTGTGGGGGCTGGGGTGG - Intronic
968566763 4:1317256-1317278 CTGGAGTGTGGGGGCTGGGGTGG - Intronic
968673077 4:1862700-1862722 CTGGGGAGTGGGGGGTGGGGGGG + Intergenic
969107726 4:4820483-4820505 CTGGAGGGCGGGAGGCGGCGAGG + Intergenic
969238557 4:5885218-5885240 CTAGAGTGGGGGAGGTGAAGGGG - Intronic
969256140 4:6002992-6003014 CTGGGATGTGAGAGGAGGTGAGG - Intergenic
969634143 4:8356304-8356326 CAGCAGTGTGGGAGGCAGTGGGG - Intergenic
969707543 4:8820113-8820135 GTGGAGTGGAGGAGGTGGGGGGG + Intergenic
969797426 4:9536932-9536954 CAGGAGTCTGGGATGTGGTCAGG + Intergenic
970421033 4:15905975-15905997 CTGGAGCAGGGGAGGAGGTGGGG + Intergenic
971323608 4:25625743-25625765 GTGGAGGGTGGGGGTTGGTGTGG + Intergenic
972741685 4:41893212-41893234 CTGGAGGGAGGGAGGTGGGAGGG - Intergenic
972778652 4:42266241-42266263 GTGGGGAGTGGAAGGTGGTGGGG - Intergenic
973619303 4:52711820-52711842 CTGGAGGGTAGGAGTTGGGGAGG - Intergenic
973799120 4:54459180-54459202 CTGGAGTATGGCAGGGGGAGGGG + Intergenic
973981472 4:56311813-56311835 CTAGAGTGTGGCAGGGGGTGCGG - Intronic
974196933 4:58586957-58586979 GGGAAGTGTGGGAGGGGGTGAGG + Intergenic
974322946 4:60375789-60375811 CTGGGCTGTGGGAAGTGGTTAGG + Intergenic
974444603 4:61963401-61963423 GTGGAGGGTGGGAGGGGGTGAGG - Intronic
974992626 4:69113660-69113682 GGGGAGGGTGGGAGGGGGTGAGG - Intronic
975006529 4:69295723-69295745 TGGGAGTGTGGGAGGGGGTGAGG - Intronic
975014858 4:69402993-69403015 TGGGAGGGTGGGAGGGGGTGAGG - Intronic
975111879 4:70637497-70637519 TTTGAGTGTTGGAGGTGGTAAGG + Intronic
975185291 4:71394923-71394945 GGGAAGTGTGGGAGGGGGTGAGG + Intronic
976298225 4:83493331-83493353 CTGGAGTGTGAGAGGGAGGGAGG + Intronic
976772949 4:88674135-88674157 CTGGGGTGTGGGAAGGGGTCAGG + Intronic
977481160 4:97577583-97577605 GGGGAGTGAGGGAGGTGGTAAGG + Intronic
977829204 4:101570464-101570486 GGGAAGTGTGGGAGGGGGTGAGG + Intronic
978531788 4:109722005-109722027 CTGGATTATGGGGGTTGGTGTGG - Intronic
979667086 4:123324217-123324239 TAGGAGGGTGGGAGGGGGTGAGG + Intergenic
980167173 4:129242890-129242912 TTGGACTTTGGGAGATGGTGTGG + Intergenic
981707083 4:147670970-147670992 ATGGAGGGTGGGGGGAGGTGGGG + Intronic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
982162596 4:152585011-152585033 CCTGAGTGTGTGGGGTGGTGGGG + Intergenic
982771466 4:159400928-159400950 CTGCAGGGTGGGAGGTGGAGCGG - Intergenic
982805701 4:159760002-159760024 CTGGAGTGGGGGAGGAAGGGAGG - Intergenic
983518200 4:168678870-168678892 GTGGCGTGTGTGTGGTGGTGTGG + Intronic
984756734 4:183331643-183331665 CTGGGGTGTGGGAGGGGCCGTGG + Intergenic
984768168 4:183415458-183415480 CTGGGGTGTTGGAGGAAGTGGGG - Intergenic
985027637 4:185754301-185754323 GTGGAAGGTGGGAGGAGGTGAGG + Intronic
985344837 4:188993166-188993188 GTGCAGTGTGGGAGTGGGTGAGG - Intergenic
985629766 5:1008498-1008520 CTGGAGAGGGGGTGGGGGTGTGG - Intergenic
986102187 5:4623148-4623170 CTGGAGTGGGGAGGGGGGTGGGG + Intergenic
986116728 5:4782511-4782533 CAGGAGAGGGGGAAGTGGTGAGG + Intergenic
986540920 5:8843047-8843069 CTGCCGTGAGGGAGCTGGTGGGG - Intergenic
987260256 5:16195655-16195677 ATGGAGTGCGGGCAGTGGTGGGG + Intergenic
987401100 5:17477807-17477829 CCTCAGTGTGGGAGGGGGTGTGG - Intergenic
988537730 5:32084034-32084056 CGGTAGTGCGGGTGGTGGTGGGG - Intronic
989223375 5:38995415-38995437 GGGGAGTTTGGGAGGAGGTGAGG + Intronic
989330433 5:40251944-40251966 CTGGAGGGTGGGAGGAGGATGGG - Intergenic
989487164 5:42004781-42004803 CTGTAGAATGGGCGGTGGTGAGG + Intergenic
989552709 5:42755146-42755168 CTGGAATGTGTAAGGTGGAGAGG - Intergenic
990564813 5:57018318-57018340 CTGGAGTCTGGGACGTGGTTGGG + Intergenic
990760837 5:59127618-59127640 CTGGAGTGTGGGGGGTGAGGTGG - Intronic
992217873 5:74543523-74543545 CTGGAGTGTGAGGGGTAGAGAGG - Intergenic
992794699 5:80245044-80245066 CTGGAGGGTGGGGAGAGGTGTGG - Intronic
993298521 5:86175945-86175967 CAGCAGGGTGGGAGGAGGTGAGG + Intergenic
993883946 5:93395158-93395180 CAGAAGAGTGGGAGGTGTTGGGG - Intergenic
994288404 5:97997293-97997315 GTGGGGTGTGGGGGGTGGGGAGG + Intergenic
995463882 5:112430863-112430885 CTTGGGGGTGGGAGGTGGTTTGG + Intergenic
995499329 5:112786545-112786567 CTGGGATGTGGGAATTGGTGGGG + Intronic
995543573 5:113207451-113207473 GTGGAGGGTGGGGGGTGGGGTGG + Intronic
996117395 5:119633631-119633653 GTGGAATGTGGGAGGTAGTGTGG - Intronic
996147294 5:119991872-119991894 CTGGAGTGTGGTGGGGGGAGGGG - Intergenic
997272858 5:132556698-132556720 CTGGAATGGGGGTAGTGGTGGGG - Intronic
997698644 5:135880937-135880959 ATGCAGTGTGGGTGGGGGTGGGG - Intronic
997874785 5:137537883-137537905 CGGGAGGGAGGGAGGTGGGGGGG - Intronic
997999038 5:138609691-138609713 CTGGAGAGGCGGAGGAGGTGGGG + Intergenic
998135035 5:139669996-139670018 CTGGCCTGGGGGAGGTGCTGGGG + Intronic
1001088743 5:168721296-168721318 CAGGATTGGGGGTGGTGGTGGGG + Intronic
1001225328 5:169940013-169940035 CTGGGGAATGGGAGGTGTTGGGG - Intronic
1001293869 5:170485376-170485398 CTTGAGTTTGGGATGTGGAGAGG - Intronic
1001399750 5:171439422-171439444 CTGGCAGGTGGGAGGTTGTGGGG + Intronic
1001483081 5:172101927-172101949 CTGGAGTGTGGGAGCGAGAGGGG + Intronic
1001718834 5:173840014-173840036 CTGGAGAGTGGGTTGGGGTGGGG + Intergenic
1001993370 5:176134864-176134886 CTGCTGAGGGGGAGGTGGTGGGG + Intergenic
1002254562 5:177949696-177949718 TTTGAGGGTGGGAGGTGGAGGGG + Intergenic
1002382388 5:178840019-178840041 CTGGGGTGGGGCAGGGGGTGCGG + Intergenic
1002483429 5:179518116-179518138 TTTGAGGGTGGGAGGTGGAGGGG - Intergenic
1002648188 5:180672656-180672678 CTGGGGTGGGGCAGGGGGTGCGG - Intergenic
1003057717 6:2837775-2837797 CAGGACTGTGGGAGCTGGGGAGG + Intronic
1003109737 6:3243526-3243548 TTGGAGTGTGGTAGGTTGGGAGG + Intronic
1003601582 6:7522408-7522430 CTGGAGAGTGGGATTTGTTGAGG - Intergenic
1003700233 6:8456311-8456333 CTAGAGTGGGGGAGGGGATGTGG - Intergenic
1003870357 6:10398171-10398193 CAGGGGTGTGGGAGCGGGTGGGG + Exonic
1003896197 6:10609900-10609922 TTGGAGGGTGAGTGGTGGTGGGG + Intronic
1003899804 6:10644018-10644040 GTGGAGTGAGGGAGGAGTTGGGG - Intergenic
1004527919 6:16426558-16426580 CTGGCCTGTGTGTGGTGGTGGGG + Intronic
1005063457 6:21797246-21797268 CGGGAGAGAGGGAGGTGGGGGGG - Intergenic
1005879345 6:30043196-30043218 CTGGGTTGTGGGAGGAGTTGAGG + Intergenic
1005959132 6:30683951-30683973 CTGGGGTGGTGGAGGGGGTGGGG - Intronic
1005982175 6:30844728-30844750 CTGGGGTGTGGAACGTGGGGAGG + Intergenic
1006400049 6:33812550-33812572 GTGGGGTGTGGGAGATGCTGAGG - Intergenic
1006582265 6:35083859-35083881 CTGGAAGGTGGGAGGGGCTGGGG + Intronic
1007430448 6:41773484-41773506 CTGGAGTGTTCAATGTGGTGTGG - Intronic
1007581578 6:42963225-42963247 CTGGGGTGGGGGTGGGGGTGGGG + Intronic
1007626340 6:43248264-43248286 CTGGAGTGTTAGAGAGGGTGAGG + Intronic
1007725138 6:43911517-43911539 GGGGAGTGTTGGGGGTGGTGGGG - Intergenic
1008195648 6:48516908-48516930 GTGGAGTGGGGGAAGTGGGGAGG - Intergenic
1008821884 6:55642785-55642807 CTTGAGGGTGGAAGGTGATGGGG - Intergenic
1010096815 6:72056265-72056287 ATGGAGGGTGGGAGGCAGTGAGG + Intronic
1010702259 6:79064460-79064482 CATGAGTGTGGGAGCTAGTGTGG - Intronic
1011424824 6:87214897-87214919 CTGGAGGGAGGGAAGGGGTGGGG - Intronic
1011955622 6:93021638-93021660 CTGGAGTGAGGGAGGGTCTGCGG + Intergenic
1013273627 6:108562641-108562663 CTGGCGTTTGGGAGGAGGTTTGG + Intronic
1013404941 6:109834716-109834738 CTTGAGAGTGTGTGGTGGTGAGG + Intergenic
1013655589 6:112243279-112243301 CTGGCCTGTGGTAGGGGGTGGGG - Intronic
1013864700 6:114681195-114681217 CTAGGGTATGGGAAGTGGTGAGG + Intergenic
1013975701 6:116075680-116075702 CTTAATTGTGGGTGGTGGTGGGG - Intergenic
1015772757 6:136785725-136785747 TTGGAGTGGTGAAGGTGGTGGGG - Intronic
1016204909 6:141457705-141457727 CTGGAGTCTGGGATGAGGTTGGG - Intergenic
1016338549 6:143035214-143035236 CTGGAGTTTGGCAGGGGGAGGGG - Intergenic
1016842546 6:148538796-148538818 TTGGAGTGGGGAAGTTGGTGGGG + Intronic
1017662315 6:156687039-156687061 GTGGAAGGTGGGAGGTGGGGCGG - Intergenic
1017877454 6:158536587-158536609 CAGGTGCGGGGGAGGTGGTGAGG - Exonic
1017881704 6:158566654-158566676 ATGGGGTGAGGGAGGTGATGGGG + Intronic
1018139388 6:160813210-160813232 GTGCAGTGCTGGAGGTGGTGTGG - Intergenic
1018291731 6:162298612-162298634 TTGGGGGGTGGGGGGTGGTGGGG - Intronic
1018655887 6:166035328-166035350 CTTGAGTGTGGGAGGTCAAGAGG + Intergenic
1018676473 6:166226529-166226551 CTGGGGGCTGGGAGGTGGTCAGG - Intergenic
1018816566 6:167336971-167336993 CTGGGGTGTGGGTCATGGTGTGG - Intronic
1018822696 6:167385544-167385566 CTGAGGTGTGTGAGGTGTTGTGG + Intergenic
1018840616 6:167514131-167514153 CTGGGGGGTGGGGGGTGGTGGGG + Intergenic
1018844433 6:167545980-167546002 TTGGAATTTGGGAGCTGGTGAGG - Intergenic
1019057563 6:169234350-169234372 GTGGAGTGTGGGTAGTTGTGTGG - Intronic
1019061757 6:169262453-169262475 CTGGAAAGAGGGAGGTGGGGAGG - Intergenic
1019479632 7:1260493-1260515 CTGCAGTGCGGCAGGTGGCGAGG + Intergenic
1019781903 7:2945400-2945422 CTGGACTGTGGGAAGTGTTGGGG + Intronic
1020111587 7:5450956-5450978 CTGGAGGGTGGGGGGTGTGGAGG + Intronic
1020119016 7:5492356-5492378 CTGGACTGTGGCAGGTTGTGGGG + Intronic
1020290527 7:6719202-6719224 CAAGATTGTGGGAGCTGGTGGGG + Intergenic
1020431860 7:8123400-8123422 GTGGATTGTGAGAGGGGGTGAGG + Intronic
1021743448 7:23712311-23712333 CTGGATTGGGGGAGGTGAGGGGG - Intronic
1021870812 7:25004419-25004441 TTGGACTGAGGGAGCTGGTGTGG + Intergenic
1021974139 7:25995356-25995378 CTGGCATGTGGGAGGTGCTCAGG - Intergenic
1022234477 7:28447647-28447669 GTGTATTGTGGGAAGTGGTGAGG + Intronic
1022776782 7:33534931-33534953 CCACAGTGTGGGAAGTGGTGTGG + Intronic
1022793335 7:33711481-33711503 CTAGAGTGTGGCATGTAGTGTGG - Intergenic
1023370825 7:39510523-39510545 CTGTTGTGGGGGAGGTGGGGGGG + Intergenic
1023663421 7:42494013-42494035 CCGCAGTGTGGGAAGTGGTTAGG - Intergenic
1023735178 7:43229479-43229501 GTGGAGAGTGGGAGGGGGAGGGG + Intronic
1023892090 7:44400257-44400279 CTGAAGTGTGGGAGGGAGGGAGG + Intronic
1024199475 7:47091143-47091165 CTTGAGTGAGGCAGGTGCTGAGG - Intergenic
1024301839 7:47892844-47892866 CGGGGGTAGGGGAGGTGGTGTGG + Intronic
1024636228 7:51292709-51292731 CTGGAGTGTGGAGGGAGGAGGGG - Intronic
1024911007 7:54447284-54447306 CTGGGGTGGGGGTGGGGGTGGGG + Intergenic
1026996081 7:74617596-74617618 CAGGGGTGTGGGAGGGGGTTTGG - Intergenic
1027266777 7:76498912-76498934 GTGGAGTGTGTGTGGAGGTGTGG + Intronic
1027732565 7:81894511-81894533 TTGGAGGGTGGGAGGCGGTGAGG - Intergenic
1028202764 7:87981518-87981540 ATGAAGAATGGGAGGTGGTGTGG + Intronic
1028236933 7:88373617-88373639 CTGGAGTTTGGCAGGGGGAGGGG - Intergenic
1028581229 7:92411538-92411560 CTGGTGTGTGTGAGGTGGGGGGG + Intergenic
1028720605 7:94026658-94026680 CTGTAGAGGGGGAGGAGGTGAGG - Intergenic
1029440539 7:100584601-100584623 CTGGAGTGTGGGGTTAGGTGGGG + Intronic
1029490094 7:100866247-100866269 CTGAGGTGCAGGAGGTGGTGTGG + Exonic
1029545348 7:101207532-101207554 CTGGGGTGGGGAAGGTGGGGAGG + Intronic
1029566284 7:101340406-101340428 CTGTAGTATTGGAGGGGGTGCGG + Intergenic
1029731971 7:102444499-102444521 CTGGAGGGTGGGGGGCGGGGGGG - Intronic
1030325208 7:108211720-108211742 CTGCTGTGGGGGAGGGGGTGAGG - Intronic
1030730531 7:112982775-112982797 TTAGGCTGTGGGAGGTGGTGGGG + Intergenic
1031415388 7:121489909-121489931 CTGGAGTTTGGGAGTTAGGGAGG - Intergenic
1032070710 7:128804774-128804796 CTGGAGAGTGAGAGGTCATGGGG + Intronic
1032240297 7:130154418-130154440 CAGGGGTGTGGTGGGTGGTGGGG + Intergenic
1032412824 7:131711316-131711338 TTGTAGGGTGGGAGGTGGGGGGG + Intergenic
1032632439 7:133668822-133668844 CTGGAGAGAGCCAGGTGGTGAGG + Intronic
1033282952 7:140018558-140018580 CTGGAGTGTGTGATGTGGGGGGG - Intronic
1033653634 7:143359848-143359870 CAGGAGTGCGGGATGTGGGGAGG + Intronic
1034189998 7:149206630-149206652 CAGGAGAAGGGGAGGTGGTGGGG + Intronic
1034253727 7:149713550-149713572 CCGGAGGGTGGGCGGTGGAGAGG + Intergenic
1034263703 7:149771967-149771989 CTGGAGTCTGAGAGGGGGAGGGG - Intronic
1034352044 7:150422596-150422618 CTGGGGTGTGGGTGAGGGTGGGG + Intergenic
1034781383 7:153886050-153886072 CTGGAGTCTGGGAGGGGTTTGGG - Intergenic
1034993174 7:155560772-155560794 CTGGAGTGAGGGAGGGGGGCCGG + Intergenic
1035078014 7:156193807-156193829 CAGGCGTGTGAGAGGTGCTGGGG - Intergenic
1035294090 7:157858078-157858100 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294100 7:157858113-157858135 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294109 7:157858145-157858167 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294119 7:157858180-157858202 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294129 7:157858215-157858237 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294138 7:157858247-157858269 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294149 7:157858280-157858302 CAGGAGTGTGGGTGGTGGCCGGG - Intronic
1035294160 7:157858315-157858337 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294183 7:157858416-157858438 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294203 7:157858484-157858506 CAGGAGTGTGGGTGGTGGCCGGG - Intronic
1035294223 7:157858551-157858573 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294233 7:157858586-157858608 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294275 7:157858723-157858745 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294285 7:157858758-157858780 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294305 7:157858825-157858847 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294336 7:157858927-157858949 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294346 7:157858962-157858984 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294355 7:157858994-157859016 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294365 7:157859029-157859051 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294375 7:157859064-157859086 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294384 7:157859096-157859118 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294395 7:157859129-157859151 CAGGAGTGTGGGTGGTGGCCGGG - Intronic
1035294406 7:157859164-157859186 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294429 7:157859265-157859287 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294449 7:157859333-157859355 CAGGAGTGTGGGTGGTGGCCGGG - Intronic
1035294469 7:157859400-157859422 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294479 7:157859435-157859457 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294513 7:157859540-157859562 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294523 7:157859575-157859597 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294535 7:157859610-157859632 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294544 7:157859642-157859664 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294554 7:157859677-157859699 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294563 7:157859709-157859731 CAGGAGTGTGGGTGGTGACGGGG - Intronic
1035294574 7:157859742-157859764 CAGGAGTGTGGGTGGTGGCCGGG - Intronic
1035294586 7:157859777-157859799 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294597 7:157859812-157859834 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294620 7:157859913-157859935 CAGGAGTGTGGGTGGTGGCTGGG - Intronic
1035294640 7:157859981-157860003 CAGGAGTGTGGGTGGTGGCCGGG - Intronic
1035544440 8:468660-468682 CTAGAGTGTGGCTGGTGGTGGGG + Intronic
1035640869 8:1184346-1184368 CTGGAGTGTGGGCGCTTCTGGGG + Intergenic
1037558215 8:20047576-20047598 CTGAAGTGTAGGAGGAGGAGTGG - Intergenic
1037674679 8:21043217-21043239 GTGGAAGGTGGGAGGTGGGGTGG - Intergenic
1037930610 8:22878059-22878081 GGGGGGTGTGGGAGGAGGTGGGG - Intronic
1038230648 8:25696287-25696309 TTGGGGTGGAGGAGGTGGTGGGG + Intergenic
1038270651 8:26072613-26072635 GTGGAGGGTGGGAGGTGGGGAGG - Intergenic
1038610447 8:29055856-29055878 GGGGAGTGTGGGATGGGGTGGGG + Intronic
1038644235 8:29349799-29349821 CTGGAGTCGGGGAGATGGAGGGG - Intronic
1038848902 8:31255232-31255254 CTGGTGTCTGGGAGGTGGTGGGG - Intergenic
1039642043 8:39234257-39234279 ATGGGGGGTGGGAGGGGGTGGGG - Intronic
1039884851 8:41649040-41649062 GTGGTGTGTGGGATGTGGAGAGG + Intronic
1039902290 8:41761864-41761886 GTGGGGGCTGGGAGGTGGTGTGG - Intronic
1039946232 8:42131216-42131238 GGGGAGTGTGGGAAGTGGGGAGG - Intergenic
1040029737 8:42813622-42813644 GTGGCGTTTGGGAGGTGGGGGGG + Intergenic
1040054922 8:43049249-43049271 TGGGAGTGGGGGAGGAGGTGAGG - Intronic
1040426858 8:47297599-47297621 GTGGGGTGGGGGAGGTGGGGAGG - Intronic
1040444131 8:47476578-47476600 AGGGAGTCTCGGAGGTGGTGAGG - Intronic
1040751133 8:50709994-50710016 ATGGAGTGTAGGAGGCAGTGGGG + Intronic
1041090857 8:54299792-54299814 CTGGAGTGTGGAGGGTGTTTGGG + Intergenic
1041251776 8:55941180-55941202 CTGCAGTGTGCAAGGTGGAGTGG - Intronic
1041755369 8:61307827-61307849 TGGGAGTGTGGGAGGGGGAGGGG - Intronic
1041769285 8:61455814-61455836 GCAGAGTGTGGGAGGTGGCGGGG - Intronic
1041862635 8:62531811-62531833 CTGGGGAGTAGGTGGTGGTGTGG - Intronic
1041946955 8:63455524-63455546 GTGGATGGTGGGAGGAGGTGAGG + Intergenic
1042021123 8:64371997-64372019 CTGGAAAATGGGAGGGGGTGAGG + Intergenic
1042084577 8:65093518-65093540 AGGAAGTGTGGGGGGTGGTGAGG + Intergenic
1043469165 8:80544854-80544876 CTGGGGGAAGGGAGGTGGTGAGG + Intergenic
1045489603 8:102658064-102658086 CTGGAGTGTGGGTGGAGGTTGGG - Intergenic
1045631631 8:104130562-104130584 CTGAAGAGGGGGATGTGGTGAGG - Intronic
1045744915 8:105406974-105406996 GTGGAATGAGGAAGGTGGTGTGG + Intronic
1046238968 8:111465202-111465224 GTGGAGGGTGGGAGGAGATGAGG + Intergenic
1046639080 8:116705494-116705516 CTGGGGTGTTGGTGGTGGGGGGG - Intronic
1047530614 8:125670970-125670992 GGGAAGTGTGGGAGGGGGTGAGG - Intergenic
1047987994 8:130256400-130256422 CTGGGGGGTGGGGGGCGGTGGGG + Intronic
1048415381 8:134222456-134222478 GGGGAGGGTGGGAGGGGGTGAGG + Intergenic
1048455692 8:134576367-134576389 CTGGAGTCTGGGTGGTGGGCAGG - Intronic
1048847094 8:138612143-138612165 CTGGAGGGTGGGATTGGGTGGGG + Intronic
1048887301 8:138918624-138918646 CTGGAGTGGGGTGTGTGGTGGGG - Intergenic
1048957886 8:139551868-139551890 ATGGTGTGTGTGTGGTGGTGGGG - Intergenic
1048967920 8:139627449-139627471 CTGGAGGGTGCCAGGGGGTGAGG + Intronic
1048985242 8:139731478-139731500 CAGGAGTGTGGGAGGGAGTGAGG + Intronic
1049047323 8:140163189-140163211 CTGGAGTGGGGGCTGTGGAGTGG - Intronic
1049094558 8:140540742-140540764 CTGCAGTGTGAGAGGTGTGGAGG - Intronic
1049426165 8:142538785-142538807 CTGGGGAGGGAGAGGTGGTGGGG - Intronic
1049436278 8:142587572-142587594 CTGCAGGGTGGGAGGGAGTGGGG + Intergenic
1049436297 8:142587621-142587643 CTGCAGGGTGGGAGGGAGTGGGG + Intergenic
1049567483 8:143348598-143348620 CTGGGGGGTGGGGGGGGGTGGGG + Intronic
1049765923 8:144355187-144355209 GTGGGGGGTGGGAGGGGGTGGGG - Intronic
1049774737 8:144399070-144399092 CTGGAGTGTGAGGGGGGGTGGGG - Intronic
1049990116 9:982254-982276 CTGGCGTCAGGGAGGTGCTGGGG + Intronic
1050029213 9:1367472-1367494 CGGGAGTGGGGGTGGGGGTGGGG + Intergenic
1050221151 9:3391657-3391679 ATGAAGTGTTGGGGGTGGTGAGG + Intronic
1050996094 9:12219353-12219375 GTGGAGTGTGGGAGGGGGGAGGG - Intergenic
1051179549 9:14395889-14395911 CTGGGGTGTGGGTGGGGGTGGGG + Intronic
1051614847 9:18997373-18997395 CTGGAGTGTGGTAAGAGGAGGGG + Intronic
1051959628 9:22742703-22742725 CAGGGGTGGGGAAGGTGGTGAGG + Intergenic
1052972077 9:34382684-34382706 CTGTAGTTTGGGAGGTGGTGGGG + Intronic
1053046976 9:34927765-34927787 CTGGAGTGTGGAAGGGAGAGTGG - Intergenic
1053163838 9:35830863-35830885 TTGGAATGTGGGAGGAGGAGGGG + Intronic
1054722857 9:68621282-68621304 CTAGAGTGTGGTAGATGGTCGGG + Intergenic
1054803974 9:69380656-69380678 CTGGAGTAGCGGAGGTGGGGTGG - Intronic
1054837355 9:69691882-69691904 ATGGGGAGTGGGAGGTGTTGGGG - Intergenic
1055225907 9:73994906-73994928 TTGGAGGGTGGGGGGAGGTGAGG + Intergenic
1055277074 9:74630150-74630172 CTGGGGTGTGAGCGGTGGTGTGG - Intronic
1055484905 9:76747196-76747218 CTGGTGTGTCAGAGGTGTTGTGG + Intronic
1055560788 9:77519644-77519666 ACGTAGGGTGGGAGGTGGTGAGG + Intronic
1055933912 9:81587634-81587656 CTGGAGTCTGGGAGGTGGCTGGG - Intronic
1056248538 9:84723640-84723662 CTGTAGTGTGGCAGGTGATCCGG + Exonic
1056540089 9:87563728-87563750 CTGCAGTCTGAGAGGCGGTGGGG - Intronic
1056754024 9:89371335-89371357 CTGGAGTGTGGTGTGTGTTGGGG + Intronic
1056821342 9:89844204-89844226 CTGGAGTGTGGTAAGTGGGGTGG + Intergenic
1057631631 9:96723783-96723805 TGGGAGAGTGGGAGGGGGTGAGG - Intergenic
1058074609 9:100638007-100638029 CTGGAGTTTGGCAGGGGGAGGGG - Intergenic
1058739984 9:107933356-107933378 CTGGAATGTGGGGGGCGGGGTGG - Intergenic
1059888397 9:118772517-118772539 CTTAAGGGTGGGAGGTGGTGTGG + Intergenic
1060061033 9:120459887-120459909 CTAGAGACTGGGATGTGGTGGGG - Intronic
1060382298 9:123187749-123187771 GTGGTGTGTGGTGGGTGGTGGGG - Intronic
1060796608 9:126516334-126516356 CTGGAGTGGTGGGGGTGGCGGGG - Intergenic
1060823327 9:126673698-126673720 CAGGAGTCAGGGAGGAGGTGAGG - Intronic
1060919439 9:127409465-127409487 ATGGGGTGGGGGAGGTGATGGGG + Intergenic
1060945401 9:127567342-127567364 CTGGACTGTGGGAGGAGGAAGGG - Intronic
1061386931 9:130295877-130295899 CTAGAGTGTGGGTGGTGATGTGG + Intronic
1061451130 9:130667509-130667531 CTGGAGTGGGGGAGCGGGCGAGG - Intronic
1061678356 9:132230760-132230782 GTGGAGGGGGGGAGGTGGAGGGG - Intronic
1062057215 9:134474922-134474944 CTGGGGTGTGGGAGGGAGTGAGG - Intergenic
1062088063 9:134658702-134658724 CTGGAGGGTGGCGGGGGGTGGGG + Intronic
1062093473 9:134690629-134690651 CTGGTGTGTGGCCGCTGGTGGGG + Intronic
1062180568 9:135189120-135189142 CGGGGGTGTGGGGTGTGGTGTGG - Intergenic
1062267653 9:135694737-135694759 CTGGGGTGTGGGAGGGGGAGGGG - Intronic
1062373970 9:136253768-136253790 TTGGGGAGTGGGAGGAGGTGGGG + Intergenic
1062480511 9:136748773-136748795 CAGGAACGGGGGAGGTGGTGCGG - Intergenic
1062649886 9:137570014-137570036 TTGGATGGTGGGTGGTGGTGGGG - Intronic
1062681595 9:137784967-137784989 CAGGCTTGTGGGAGGGGGTGAGG + Intronic
1185907136 X:3945895-3945917 TGGGAGAGTGGGAGGGGGTGAGG - Intergenic
1186471024 X:9822315-9822337 CTGCAGTGGGGGAGGTGGGCAGG + Intronic
1186731985 X:12419920-12419942 ATGGAGTGTGGGAGGAGGTGAGG - Intronic
1187896347 X:23983186-23983208 ATGGAGTGTAGGAAGTGGTGGGG + Intergenic
1188359716 X:29237820-29237842 CAAGAGTGTGGGAGGAGGAGAGG + Intronic
1188438485 X:30189944-30189966 CTGGAGTGGGGCAGGAGGGGTGG - Intergenic
1188850440 X:35125511-35125533 CTGGAGTGGGGGCAGGGGTGGGG + Intergenic
1189377404 X:40476249-40476271 CTGGAATGGGGGTGGGGGTGGGG - Intergenic
1190681687 X:52831473-52831495 CTGGAGTGTCTGAGGTGGCAGGG - Intergenic
1191110551 X:56800429-56800451 GTGGAGTGTGTGGGATGGTGTGG + Intergenic
1191810617 X:65183415-65183437 TTGGAGGGTGGGAGGGGGTGAGG + Intergenic
1191954128 X:66625477-66625499 CTGCTGTGTGGGTGGGGGTGAGG - Intronic
1192100661 X:68261109-68261131 ATGGAGAGTGGGAGCTAGTGTGG - Intronic
1192189297 X:68981039-68981061 CTGGAGTTTGGGTGGCGGGGAGG - Intergenic
1192252934 X:69428380-69428402 GGGGAGAGTGGGAGGTGATGAGG - Intergenic
1192292809 X:69815424-69815446 CTGGAGTTGGGGTGGGGGTGGGG + Intronic
1192373373 X:70534336-70534358 TGGGAGTGAGGGAGGTGCTGAGG + Intronic
1192722615 X:73715595-73715617 TGGGAGTGTGGGAGGGGGAGGGG - Intergenic
1195086300 X:101417567-101417589 CTGCTGTGACGGAGGTGGTGGGG - Intergenic
1195264184 X:103164143-103164165 CTGGAGGGTGGGAGGGGAAGTGG + Intergenic
1195688525 X:107605534-107605556 CTGAAGGGCTGGAGGTGGTGTGG + Intergenic
1196006948 X:110846835-110846857 TGGGATGGTGGGAGGTGGTGGGG + Intergenic
1197423452 X:126266684-126266706 GTGGAGTGGGGGAAGGGGTGAGG - Intergenic
1197641968 X:128976936-128976958 CTGGAGTATGGCAGATGGGGAGG - Intergenic
1197897429 X:131330290-131330312 CTGAAGTGAGGTTGGTGGTGGGG + Intronic
1198051279 X:132955752-132955774 CTGTAAAGTGGGTGGTGGTGGGG - Intronic
1198122874 X:133611216-133611238 GTGGGGTGTGGGTGGGGGTGTGG + Intronic
1198235791 X:134734860-134734882 CCAGGGGGTGGGAGGTGGTGGGG - Intronic
1198365530 X:135936002-135936024 CTGTCGTGGGGTAGGTGGTGGGG - Intergenic
1198804488 X:140480782-140480804 TTGGTGTTTGGGTGGTGGTGGGG - Intergenic
1198807083 X:140503668-140503690 CGGGAGTGGGGGTGGGGGTGGGG + Exonic
1199010644 X:142754253-142754275 CTGGAGTGGGTTAGGTGCTGGGG + Intergenic
1199118523 X:144021857-144021879 ATGGAGTGGTGGGGGTGGTGCGG + Intergenic
1199438537 X:147841983-147842005 GGGGAATGGGGGAGGTGGTGGGG - Intergenic
1199631896 X:149782818-149782840 GTGGAGTGGGGGGGGGGGTGAGG - Intronic
1201170388 Y:11255741-11255763 GTGGAGTGGGGGAGGGGGTAGGG + Intergenic
1201800534 Y:17950047-17950069 CTGGGGTGGGGGAAGGGGTGAGG + Intergenic
1201801019 Y:17955909-17955931 CTGGGGTGGGGGAAGGGGTGAGG - Intergenic
1202036999 Y:20646010-20646032 CTGCAGTGTGGGTGGGGGTGGGG + Intergenic