ID: 1148151621

View in Genome Browser
Species Human (GRCh38)
Location 17:45399921-45399943
Sequence CTTTGGAAGGGCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266286
Summary {0: 8, 1: 1132, 2: 25663, 3: 79938, 4: 159545}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148151611_1148151621 11 Left 1148151611 17:45399887-45399909 CCAGGCACAACGGCTCATGCCCA 0: 1
1: 3
2: 166
3: 2168
4: 15262
Right 1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545
1148151610_1148151621 15 Left 1148151610 17:45399883-45399905 CCAGCCAGGCACAACGGCTCATG 0: 1
1: 9
2: 233
3: 883
4: 2662
Right 1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545
1148151613_1148151621 -8 Left 1148151613 17:45399906-45399928 CCCATAATCCTAGTGCTTTGGAA 0: 3
1: 138
2: 1344
3: 12032
4: 86713
Right 1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545
1148151608_1148151621 17 Left 1148151608 17:45399881-45399903 CCCCAGCCAGGCACAACGGCTCA 0: 1
1: 3
2: 54
3: 308
4: 1415
Right 1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545
1148151607_1148151621 18 Left 1148151607 17:45399880-45399902 CCCCCAGCCAGGCACAACGGCTC 0: 1
1: 0
2: 8
3: 83
4: 637
Right 1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545
1148151609_1148151621 16 Left 1148151609 17:45399882-45399904 CCCAGCCAGGCACAACGGCTCAT 0: 1
1: 3
2: 88
3: 621
4: 2382
Right 1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545
1148151614_1148151621 -9 Left 1148151614 17:45399907-45399929 CCATAATCCTAGTGCTTTGGAAG 0: 2
1: 12
2: 119
3: 946
4: 5780
Right 1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148151621 Original CRISPR CTTTGGAAGGGCAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr