ID: 1148155081

View in Genome Browser
Species Human (GRCh38)
Location 17:45418979-45419001
Sequence TCTAGGGCCCCCCCACCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148155075_1148155081 8 Left 1148155075 17:45418948-45418970 CCACTGGCAGAGACCACCATCTC 0: 1
1: 0
2: 1
3: 17
4: 255
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82
1148155076_1148155081 -5 Left 1148155076 17:45418961-45418983 CCACCATCTCTTCTCCACTCTAG 0: 1
1: 2
2: 3
3: 39
4: 407
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82
1148155072_1148155081 17 Left 1148155072 17:45418939-45418961 CCCACAGGCCCACTGGCAGAGAC 0: 1
1: 1
2: 0
3: 13
4: 172
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82
1148155070_1148155081 23 Left 1148155070 17:45418933-45418955 CCCATGCCCACAGGCCCACTGGC 0: 1
1: 0
2: 1
3: 24
4: 267
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82
1148155073_1148155081 16 Left 1148155073 17:45418940-45418962 CCACAGGCCCACTGGCAGAGACC 0: 1
1: 1
2: 3
3: 26
4: 253
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82
1148155074_1148155081 9 Left 1148155074 17:45418947-45418969 CCCACTGGCAGAGACCACCATCT 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82
1148155071_1148155081 22 Left 1148155071 17:45418934-45418956 CCATGCCCACAGGCCCACTGGCA 0: 1
1: 0
2: 4
3: 34
4: 371
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82
1148155068_1148155081 24 Left 1148155068 17:45418932-45418954 CCCCATGCCCACAGGCCCACTGG 0: 1
1: 0
2: 5
3: 40
4: 354
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82
1148155079_1148155081 -8 Left 1148155079 17:45418964-45418986 CCATCTCTTCTCCACTCTAGGGC 0: 1
1: 1
2: 3
3: 29
4: 281
Right 1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148155081 Original CRISPR TCTAGGGCCCCCCCACCAAG TGG Intronic
900519781 1:3100003-3100025 TCTACGGCTCCCTCACCCAGGGG - Intronic
901007264 1:6178176-6178198 TCTGGGGCCAACCCACCGAGGGG + Intronic
903861985 1:26370193-26370215 ACCAGAGGCCCCCCACCAAGGGG + Intronic
906198337 1:43943767-43943789 CCCAGGGCCCCCTCACCATGGGG + Intergenic
906537104 1:46557128-46557150 TCTAGGATCTCCCCATCAAGTGG - Intergenic
906794793 1:48688285-48688307 TCTAGGTCCCACCCACTAGGAGG - Intronic
912516000 1:110216884-110216906 CCTAGGGCCCCAGCACCTAGAGG + Intronic
915410092 1:155694266-155694288 TCAAGGGCCCTCTCACCCAGAGG - Intronic
920383275 1:205548394-205548416 TCGAGGGCCCCCCCCCCAGTGGG + Intergenic
921162783 1:212484956-212484978 TCTAGGGAACCCCCCACAAGAGG - Intergenic
922718778 1:227889864-227889886 TCTGGGGCACTCCCTCCAAGGGG - Intergenic
1066795004 10:39110340-39110362 TCTTGGGCCCTCTCACCTAGAGG + Intergenic
1070216104 10:74382843-74382865 TCTAGGCCACCTACACCAAGGGG - Intronic
1073112510 10:101071008-101071030 TCAAGGTGCTCCCCACCAAGAGG - Intergenic
1077219796 11:1410865-1410887 TCGAAGGCCCTCCTACCAAGTGG - Intronic
1089095308 11:115915301-115915323 TCTGGGGCCCCTGCACCATGGGG + Intergenic
1089605619 11:119639737-119639759 TCTAGGGCCTCCCCACCCTGGGG - Intronic
1096256278 12:50064036-50064058 TCTTGGGCAGCCCCACCCAGAGG + Intronic
1096766265 12:53892801-53892823 CCCAGGGCCCCCCAACCAAAAGG + Intergenic
1100853617 12:98739097-98739119 TCCAGGGCCCCACAGCCAAGTGG + Intronic
1103701532 12:122850684-122850706 ACCAGGGCCCCCCAACCCAGCGG - Intronic
1105378223 13:19863780-19863802 TCTTCGGCCACCCCACCGAGGGG - Intergenic
1105585433 13:21738730-21738752 TCTAGGGCCACATCACCAACTGG - Intergenic
1118914842 14:70094161-70094183 TCCATGGCCTCCCCACCAATGGG + Intronic
1119639520 14:76304286-76304308 GCTATGGCCCCCCACCCAAGTGG - Intergenic
1120732163 14:88015967-88015989 TCTGGGGTCCCCCAGCCAAGAGG - Intergenic
1127722106 15:61713084-61713106 TCCAGGCCCCGTCCACCAAGTGG + Intergenic
1132651588 16:1023626-1023648 TCAAGGGCCACCCAACCAAGGGG - Intergenic
1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG + Intergenic
1134227597 16:12403605-12403627 CATAGCGCCCCACCACCAAGAGG - Intronic
1135145951 16:19962852-19962874 TCCAGGGCCCCCACACTATGTGG - Intergenic
1144455463 17:15414889-15414911 TCTAGGACACACCCACCAAATGG + Intergenic
1144784519 17:17824230-17824252 TCTAGGGCAGCCCCAGGAAGGGG + Intronic
1145267261 17:21385803-21385825 TCTGGGGCATCCCCACCCAGCGG - Intronic
1146054501 17:29574384-29574406 TCTAGGGCACCCTCAGCAAAGGG - Exonic
1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG + Intronic
1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG + Intergenic
1150427436 17:65087695-65087717 TCTAGGGCCCAGCCAGCAAAGGG + Intergenic
1150490988 17:65574155-65574177 TGTAGGGCCTCCCCAGCCAGGGG - Intronic
1151266856 17:72963126-72963148 TCTAGGGCACACACACCATGGGG + Intronic
1151749188 17:76027133-76027155 CCAAGGGCTCCCCCGCCAAGGGG - Exonic
1152580679 17:81164385-81164407 TCTGGGGCCCACCTACCAGGAGG - Intronic
1155447178 18:25924280-25924302 TCTAGGGCCACCACTCCATGGGG + Intergenic
1161016554 19:1986400-1986422 GCTGGGGCCCCCCCACCACGCGG - Exonic
1162476812 19:10905308-10905330 TCTATGTCCCCACCTCCAAGAGG + Intronic
1166891228 19:45995107-45995129 TCCAGGCCCTCCCCACCACGTGG + Intergenic
926120550 2:10239250-10239272 TCTAGAGCCCACCCATCATGGGG + Intergenic
932576931 2:72967729-72967751 TCCAGGCCCCCTCCACCTAGGGG + Intronic
935670712 2:105554872-105554894 TCTAAGGTCCCCACACAAAGTGG - Intergenic
936152235 2:110028109-110028131 TCTAGGGCCACCCAGCCCAGGGG - Intergenic
936192442 2:110343303-110343325 TCTAGGGCCACCCAGCCCAGGGG + Intergenic
937530459 2:122821262-122821284 TCCAGAGCCCACCCAGCAAGTGG + Intergenic
947034892 2:225841243-225841265 TCTCTGGCTCCCCCACCCAGTGG + Intergenic
949034844 2:241811650-241811672 CCGAGGGCCCCTCCAGCAAGAGG + Intronic
1169724639 20:8715680-8715702 TCCAGGACCCCCTCCCCAAGTGG + Intronic
1177305227 21:19306659-19306681 TCTAGGGCCCACCTAGGAAGAGG - Intergenic
1177909833 21:27017473-27017495 TGTATGGCCCCTCCACCAACAGG - Intergenic
1179392007 21:41002552-41002574 ACTAAGGCCCCACCAGCAAGGGG - Intergenic
1179967947 21:44817802-44817824 TCTAGAGCCCCGCCCCTAAGTGG - Intronic
1181465878 22:23110394-23110416 TCTGGGGCCCTCCCACCAGGAGG + Intronic
1182452986 22:30432348-30432370 TCTAGGGCCCTGCCACCTGGAGG + Intergenic
1183860538 22:40666605-40666627 TCTAGAGCCCACACAGCAAGTGG - Intergenic
1185197265 22:49479731-49479753 TCCAGGGCCCCCGCTCCAGGAGG + Intronic
952834289 3:37590707-37590729 ACTAGGGCCCACCCACAGAGTGG - Intronic
954083171 3:48224280-48224302 TCCATGACCTCCCCACCAAGAGG - Intronic
960418541 3:117414788-117414810 TATGGGGCACCCTCACCAAGGGG - Intergenic
960808084 3:121603303-121603325 TCTAGGGCATCCTCAGCAAGAGG + Intronic
968228087 3:196988495-196988517 TCTAGGTTACCCCCAGCAAGAGG + Intergenic
968515198 4:1012706-1012728 TCCAGGGCCCCCTCACCCATGGG + Intronic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
975683653 4:76898643-76898665 TCTCCGGCGCCCCCTCCAAGGGG + Intergenic
980769970 4:137358600-137358622 CCAAGGGACCACCCACCAAGAGG + Intergenic
984873553 4:184348154-184348176 TTTCGGGCCCCCTCAGCAAGAGG + Intergenic
998386918 5:141762474-141762496 TCCAGCGCCCCCGCACCACGTGG - Intergenic
1003145448 6:3506359-3506381 CCTAGGGCCACCCCTCCAGGCGG - Intergenic
1003698637 6:8438045-8438067 TCTGGGGCCCTTCAACCAAGGGG + Intergenic
1013118210 6:107119105-107119127 ACTAGGGCCCCAGCACCCAGAGG + Intergenic
1015979200 6:138821853-138821875 TCTTCGGCCTCCCCATCAAGGGG - Intronic
1025026375 7:55519693-55519715 TCCAGGGCCCCCACGCCATGGGG + Intronic
1029535599 7:101155466-101155488 GTTAGGGCCCCGCCACCCAGGGG - Intronic
1040323629 8:46330348-46330370 CCCAGGGCCCCCCCATCATGGGG - Intergenic
1047783924 8:128135337-128135359 TCTTGGGCAACCACACCAAGAGG - Intergenic
1048121084 8:131582656-131582678 TCAACCTCCCCCCCACCAAGAGG + Intergenic
1049791246 8:144473667-144473689 TCCCAGGCCCCCCCGCCAAGTGG + Exonic
1058753264 9:108060243-108060265 TCTAGGGCCCACTGAACAAGAGG + Intergenic
1059104188 9:111497489-111497511 TCTAGAGCCCACACAGCAAGTGG - Intergenic
1060560645 9:124539980-124540002 TCTAGGGATCCCCCACCAAAGGG - Intronic
1061283701 9:129610814-129610836 TCTACGGCCCCTCCTCCAGGTGG - Intronic
1061620043 9:131806034-131806056 TCAAGGCCACACCCACCAAGGGG - Intergenic
1192979022 X:76318985-76319007 TCTAGGGCCCCACCAACCACTGG - Intergenic