ID: 1148155439

View in Genome Browser
Species Human (GRCh38)
Location 17:45422331-45422353
Sequence TGCCTCAGCCAGGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7917
Summary {0: 1, 1: 2, 2: 36, 3: 654, 4: 7224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148155430_1148155439 18 Left 1148155430 17:45422290-45422312 CCATGTGGTCCCACGTTCTCAAG 0: 1
1: 0
2: 1
3: 24
4: 344
Right 1148155439 17:45422331-45422353 TGCCTCAGCCAGGGAGGCTGAGG 0: 1
1: 2
2: 36
3: 654
4: 7224
1148155432_1148155439 9 Left 1148155432 17:45422299-45422321 CCCACGTTCTCAAGGTGCTGAGG 0: 1
1: 0
2: 0
3: 30
4: 726
Right 1148155439 17:45422331-45422353 TGCCTCAGCCAGGGAGGCTGAGG 0: 1
1: 2
2: 36
3: 654
4: 7224
1148155434_1148155439 8 Left 1148155434 17:45422300-45422322 CCACGTTCTCAAGGTGCTGAGGC 0: 1
1: 0
2: 1
3: 23
4: 581
Right 1148155439 17:45422331-45422353 TGCCTCAGCCAGGGAGGCTGAGG 0: 1
1: 2
2: 36
3: 654
4: 7224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148155439 Original CRISPR TGCCTCAGCCAGGGAGGCTG AGG Intronic
Too many off-targets to display for this crispr