ID: 1148156449

View in Genome Browser
Species Human (GRCh38)
Location 17:45427585-45427607
Sequence CCCTACCCTGGACTTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148156443_1148156449 -1 Left 1148156443 17:45427563-45427585 CCTTGCGGGGGCAGGGCCAACTC 0: 1
1: 0
2: 2
3: 11
4: 108
Right 1148156449 17:45427585-45427607 CCCTACCCTGGACTTTGTTGGGG 0: 2
1: 0
2: 0
3: 10
4: 133
1148156432_1148156449 30 Left 1148156432 17:45427532-45427554 CCTGGGACAACTAAGAGCAGGGA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1148156449 17:45427585-45427607 CCCTACCCTGGACTTTGTTGGGG 0: 2
1: 0
2: 0
3: 10
4: 133
1148156442_1148156449 0 Left 1148156442 17:45427562-45427584 CCCTTGCGGGGGCAGGGCCAACT 0: 1
1: 0
2: 1
3: 5
4: 104
Right 1148156449 17:45427585-45427607 CCCTACCCTGGACTTTGTTGGGG 0: 2
1: 0
2: 0
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148156449 Original CRISPR CCCTACCCTGGACTTTGTTG GGG Intronic
900491704 1:2952538-2952560 ACCGACCCTGGGCGTTGTTGGGG - Intergenic
904521946 1:31102453-31102475 CCCCACCCGGGACTCTGTTGTGG - Intergenic
908385955 1:63642082-63642104 CCCAACCCTGGACTGTGGAGTGG - Intronic
908688725 1:66752902-66752924 CCCAACTCTGGCCTTTCTTGGGG + Intronic
909479310 1:76114406-76114428 CACTACCCTGGACCTGGTTCAGG - Intronic
909758099 1:79253024-79253046 ACCTACCCTTGACTTTGTTAAGG + Intergenic
910675440 1:89811807-89811829 CCCTACTTTGCACTTTGTTCTGG + Intronic
912776233 1:112508126-112508148 CCCCACCCTGGCCTCTGGTGCGG + Intronic
913710730 1:121480622-121480644 CCTTATCCTGGACTTTTTTTTGG - Intergenic
915311643 1:155008350-155008372 CCCTACCCTGTACTGGGCTGGGG - Intronic
916965356 1:169934871-169934893 CCCTTCCCCAGAGTTTGTTGGGG + Intronic
917535099 1:175868797-175868819 CCCTTCCCTGAACATTCTTGAGG + Intergenic
917668521 1:177249193-177249215 CCCTTTCCTGGACATTGTTTTGG + Intronic
918453507 1:184683991-184684013 ACATACCCTGGACTTTGATTTGG - Intergenic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
920054162 1:203180640-203180662 CCCCACCCAGGACTATGCTGTGG - Exonic
922345093 1:224689925-224689947 CCCAAACCTGCACTTTGTAGGGG - Intronic
923059799 1:230460820-230460842 CCCTCCCCTGGACTTGCCTGGGG + Intergenic
1064654901 10:17547178-17547200 GCCTACCCTGGGCTTTGTGGGGG + Intergenic
1064918739 10:20492031-20492053 ACCTACCTTGTACATTGTTGTGG + Intergenic
1066988376 10:42488494-42488516 CCATTTCCTGGAGTTTGTTGTGG + Intergenic
1069191607 10:65498139-65498161 ACCTACCCTGGAATTTGTGTTGG - Intergenic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1072865510 10:99056530-99056552 CCCTTCCCAGAACTTAGTTGAGG - Intronic
1075419803 10:122292235-122292257 TACTTCCCAGGACTTTGTTGGGG + Intronic
1076765499 10:132630858-132630880 CCCAAGCCCGGACTTTGTTCGGG + Intronic
1079134507 11:17768769-17768791 CCCTGCCCTGGCCTTTGTATGGG - Intronic
1080387224 11:31817283-31817305 CCCATCTCTAGACTTTGTTGCGG + Intronic
1081633007 11:44702069-44702091 CCTTACACTGGATTTTGTGGGGG - Intergenic
1088452387 11:109996090-109996112 CCCTACCAGGGACTCTGTTCAGG - Intergenic
1090231600 11:125111077-125111099 CCCTCTCCTGGACGGTGTTGTGG + Intronic
1090879780 11:130823505-130823527 CCATCCCCTGCACCTTGTTGAGG + Intergenic
1091128718 11:133125252-133125274 CCCTTCCCTGGATTCAGTTGTGG + Intronic
1091548009 12:1517330-1517352 CCCCACCCTGGGATTTGGTGGGG + Intergenic
1092892849 12:12985317-12985339 CCCTACCCTGGATTATTTTTAGG - Intronic
1093092644 12:14938529-14938551 TCCAACCCTGGACTTTGTGTTGG + Exonic
1096814956 12:54196097-54196119 CCCTCCTCTGGCCTTTGCTGGGG + Intergenic
1096956290 12:55529604-55529626 CCCAACCCTGGATTTTGCTCAGG - Intergenic
1101857298 12:108454663-108454685 GCCTTCCCTGAACCTTGTTGTGG + Intergenic
1102016550 12:109651647-109651669 CCCTGCTCTAGACTTTGTTCTGG - Intergenic
1103350372 12:120279250-120279272 CCTTACCCTGGTATTTGTTGAGG + Intergenic
1104871380 12:132000349-132000371 CACTGACCTGGATTTTGTTGAGG + Intronic
1108042664 13:46353645-46353667 CAGTACCATGGACTTTGTCGTGG - Intronic
1111886920 13:94032969-94032991 GCCTACTGTGGACTTTGTTTTGG + Intronic
1118706009 14:68480841-68480863 CCCTCCCCTGAAGTTGGTTGGGG - Intronic
1119821162 14:77616961-77616983 CCCTACCCCGGACCTGGATGCGG - Intergenic
1120558686 14:85962456-85962478 CCTTACTTTGGGCTTTGTTGAGG + Intergenic
1121437280 14:93928066-93928088 CTCTACCCAGGACTCTGTTTAGG + Intronic
1122116176 14:99528382-99528404 CCCAACCCTGGCCTTCGGTGTGG - Intronic
1122878673 14:104680217-104680239 CCCTACCCTGGACTTTGGCCAGG + Intergenic
1124848868 15:33316840-33316862 CTCTAACATGGTCTTTGTTGCGG + Intronic
1127704535 15:61533957-61533979 CCTTACCCTGACCCTTGTTGTGG + Intergenic
1128327604 15:66735206-66735228 CCCAGCCCTGGACTATGGTGTGG - Intronic
1128807493 15:70541891-70541913 CCCTACCCTGGCTTTCTTTGTGG + Intergenic
1144264321 17:13553499-13553521 CTCTACCCTTGATTTTGTTGGGG + Intronic
1144431224 17:15193574-15193596 CCCTGCCCTGGAATTTCTTTTGG + Intergenic
1144861040 17:18302318-18302340 CCCCACACTGGGCTTTGTGGTGG - Exonic
1144888187 17:18477921-18477943 CCCAACCCTGGCCTCTGCTGAGG - Intronic
1145144019 17:20466382-20466404 CCCGACCCTGGCCTCTGCTGAGG + Intronic
1145297269 17:21601529-21601551 CCCAACACTGGACCTTGTTGGGG + Intergenic
1145366685 17:22271371-22271393 CCTGACACTGGACTTTGTTGGGG - Intergenic
1145791847 17:27632325-27632347 CCCGACCCTGGCCTCTGCTGAGG - Intronic
1145990630 17:29077414-29077436 CCCTCCCCTTGACTTTGCTATGG + Exonic
1146127002 17:30237961-30237983 CCCCACCCTGTACTGTGGTGTGG + Intergenic
1146934919 17:36807518-36807540 CGCTGCCCTGTACTTTCTTGAGG - Intergenic
1148156449 17:45427585-45427607 CCCTACCCTGGACTTTGTTGGGG + Intronic
1148197956 17:45728473-45728495 CACTAGCCTGGGCTTTCTTGTGG - Intergenic
1149618245 17:58020239-58020261 TCCTAGCCTGGATTTAGTTGAGG - Intergenic
1150388123 17:64776216-64776238 CCCTACCCTGGACTTTGTTGGGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1162828998 19:13272453-13272475 CCCTACCCTGCATTCTGATGAGG - Intronic
1163294259 19:16402098-16402120 GCCTATCTTGGACTTTGTTCTGG + Intronic
1164203293 19:23036405-23036427 CTCTAACTTAGACTTTGTTGGGG + Intergenic
1164393368 19:27844302-27844324 CCCTTCCCAGGTCTCTGTTGTGG - Intergenic
1164806981 19:31124564-31124586 CCCTACCCAGGCCTTTGCTGTGG - Intergenic
1166047422 19:40237757-40237779 CACCACCCTGGACCTTGGTGGGG + Intronic
1166047436 19:40237801-40237823 CACCACCCTGGACCTTGGTGGGG + Intronic
1166047450 19:40237845-40237867 CACCACCCTGGACCTTGGTGGGG + Intronic
926040701 2:9670559-9670581 CCCTTTCCTGGATTTTTTTGGGG + Intergenic
928560291 2:32476455-32476477 ACCTACTCTGGACTTTTTTTTGG + Intronic
930174671 2:48289558-48289580 CCCTCCCCTGGACTTCGGTAAGG - Intergenic
935190846 2:100777684-100777706 CCCTTCCCTGGCCCCTGTTGCGG - Intergenic
937884648 2:126891531-126891553 CCCTACCCTCGACTGTATTCCGG - Intergenic
937973108 2:127565280-127565302 CCACACCCTGGACTGAGTTGGGG - Exonic
945075014 2:206030134-206030156 CCTTACCCTGACCTCTGTTGTGG - Intronic
945184550 2:207126460-207126482 CCCTACCCTGTACCATGCTGAGG + Intronic
946430663 2:219625609-219625631 CCCTACCTTGAATTTTGTTTTGG - Intergenic
946672544 2:222121592-222121614 TCTTACCCTGGACTTTCTTCAGG - Intergenic
949008306 2:241663464-241663486 CTCTACACTTGACTTTTTTGAGG - Intronic
1169724396 20:8713602-8713624 CCCCACCCTGGACTCTGTGTTGG + Intronic
1175232309 20:57481601-57481623 CCCTGCCCTGGGCTGTGTCGGGG + Intergenic
1176140255 20:63541829-63541851 CTCTGCCCTGGTCTTTGTCGGGG - Intronic
1181266938 22:21635951-21635973 CCAGTCCCTGGACTTTGCTGAGG + Intronic
1183860956 22:40669550-40669572 CCTGTACCTGGACTTTGTTGGGG + Intergenic
953381298 3:42474623-42474645 CCACACCCTGGGCTCTGTTGGGG - Intergenic
953580238 3:44147241-44147263 CCTGAGCATGGACTTTGTTGGGG - Intergenic
956420935 3:69085607-69085629 CCCTACCCTGGAGCTGGCTGGGG + Intronic
960183918 3:114615581-114615603 CTGTACTCTGAACTTTGTTGGGG + Intronic
961665372 3:128490734-128490756 CCCTCCCCGGGAGTTTGTTTGGG - Intronic
962309635 3:134315927-134315949 GCCTCCCCTGGACTGTGCTGTGG + Intergenic
962475012 3:135747899-135747921 CCCCACCCTGGACTTTGATATGG - Intergenic
964052159 3:152407956-152407978 ACATACACTGGAGTTTGTTGGGG + Intronic
964168108 3:153733949-153733971 CCCTTTCCTTGACTTTGTTTTGG - Intergenic
965658842 3:171019353-171019375 CCCTTCCCTGGATGTTGATGCGG - Intronic
967035466 3:185645820-185645842 CCTTACCCTGGACCTTGGGGTGG - Intronic
967370741 3:188742962-188742984 ACCTAACCTGGACCTTGTAGAGG - Intronic
967772102 3:193345021-193345043 TTGTAACCTGGACTTTGTTGTGG + Exonic
974571005 4:63648934-63648956 CCCTCTCCAGGAGTTTGTTGAGG - Intergenic
984952752 4:185019162-185019184 CCCTACCCAGGCCTTTGGGGAGG - Intronic
986227987 5:5835161-5835183 CCCTACCCTCTACTCTGTTCAGG - Intergenic
986410760 5:7476338-7476360 CCCACGCCTGGACATTGTTGTGG + Intronic
989272780 5:39552360-39552382 ACCTGCCCTGGACATTGTGGTGG + Intergenic
991990033 5:72328475-72328497 CCCTCCCCTTGACTTTGGTCTGG - Intronic
998894692 5:146787147-146787169 CCTTGCCATGGCCTTTGTTGAGG + Intronic
1000040325 5:157480411-157480433 CCCTGCCCAGGGCTTGGTTGAGG - Exonic
1009807271 6:68616988-68617010 CCCTAACCTGCACATTGTTTAGG + Intergenic
1009903825 6:69843508-69843530 CCACACCCTTGACTTTGATGAGG + Intergenic
1023649593 7:42355016-42355038 CACTAGCCTGGATTTGGTTGTGG - Intergenic
1023861757 7:44220957-44220979 CCCTCCCCTGGGCTGTGTGGAGG - Intronic
1026830709 7:73608287-73608309 CCCTAACCAGGACTTTCTGGAGG - Intronic
1026897628 7:74019442-74019464 CCCTACCCTGAACTGTGTATGGG - Intergenic
1027125967 7:75556936-75556958 CCACACCCTGCACTTTTTTGGGG - Intronic
1029502442 7:100940769-100940791 TCGCACACTGGACTTTGTTGGGG - Intergenic
1029795353 7:102888779-102888801 CTCTCCCCTGGACTTTGCTCTGG - Intronic
1030231208 7:107209969-107209991 CCCCACCCTGGGCATGGTTGGGG + Intronic
1031297790 7:120025931-120025953 CTCAACCCTGGACTTTATTCAGG + Intergenic
1031941476 7:127793883-127793905 CCATACTCAGGAATTTGTTGGGG - Intronic
1034677162 7:152900227-152900249 GCCTGCACTGGACTTTGCTGTGG + Intergenic
1039469234 8:37803281-37803303 CCCCTCTCTGGACTTTGCTGAGG - Intronic
1039925620 8:41929230-41929252 CCCTACTTTGGATTTTGTAGGGG - Intergenic
1045683111 8:104683572-104683594 CCCTACCCTGATGTTTGTTTTGG - Intronic
1046021648 8:108672490-108672512 CCCTACTTAGGACTATGTTGTGG + Intronic
1046065464 8:109191385-109191407 ACCTACCCTGAACATTTTTGTGG - Intergenic
1049400117 8:142422309-142422331 CCCTTTCTTGAACTTTGTTGAGG - Intergenic
1054903496 9:70393554-70393576 CCCATCCCTGGACTTGGGTGGGG - Intronic
1060219290 9:121755861-121755883 CCCTACCTTGGGCTATGCTGAGG - Intronic
1062265400 9:135684553-135684575 CCCTTCCCTGGAGAGTGTTGGGG - Intergenic
1062725050 9:138068136-138068158 CCTGTCCCTGGCCTTTGTTGTGG - Intronic
1190448333 X:50553390-50553412 CTCTACCCTGGAGTTACTTGTGG + Intergenic
1192259010 X:69492764-69492786 CACTTCCCTGGACTCTGTGGGGG + Intergenic
1192332254 X:70185204-70185226 CCATCTCCTGGACTTTGTTCAGG + Intronic
1195619998 X:106943318-106943340 CCCTAACCTGGACTTGTCTGTGG - Intronic
1200708989 Y:6466996-6467018 TCATACACTTGACTTTGTTGTGG - Intergenic
1201025123 Y:9697713-9697735 TCATACACTTGACTTTGTTGTGG + Intergenic
1201274517 Y:12285502-12285524 CCCTTCCCAGGTCTCTGTTGTGG - Intergenic