ID: 1148156776

View in Genome Browser
Species Human (GRCh38)
Location 17:45429230-45429252
Sequence GGTTATATAACCTCCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 2, 3: 1, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148156776 Original CRISPR GGTTATATAACCTCCCAGCA GGG Intronic
903802675 1:25981439-25981461 GGTTTTATACCCTCCCGGGAGGG + Intronic
904368883 1:30035911-30035933 CTTTATATGACCTCCCAGGAGGG - Intergenic
907381695 1:54096046-54096068 TGTTATATTACCACCCGGCAGGG + Intronic
907700602 1:56783908-56783930 TGTTATGTAACCTCCCAGCAAGG - Intronic
908543008 1:65139449-65139471 GATTACATACCCTCCCAGTAGGG - Intergenic
917601495 1:176578763-176578785 GCCTATATAACCTCTCAGAAAGG + Intronic
918144492 1:181743518-181743540 GGTTATGTGACCTCCCTACAAGG - Intronic
918531322 1:185525194-185525216 GATTCAATGACCTCCCAGCAGGG + Intergenic
919235757 1:194839949-194839971 GTTTATATAAAATCCAAGCAAGG + Intergenic
920407493 1:205728413-205728435 GGTTATATAATATCCCATAATGG - Intronic
924466064 1:244300209-244300231 TGTAATAAAACCTCCCAGGATGG + Intergenic
1064229136 10:13514192-13514214 GGTTCTACAACCTCCCAGCCTGG + Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1074782895 10:116814795-116814817 AGGTATGTAACTTCCCAGCAAGG - Intergenic
1077983172 11:7322141-7322163 GGTTGTAAATACTCCCAGCAGGG + Intronic
1085267941 11:75248381-75248403 GATTATATAAGATCCCAGGATGG + Intergenic
1096587742 12:52634061-52634083 GGCTTTCTAACCTCCAAGCATGG + Intergenic
1098293623 12:68982083-68982105 GGTTATATAACTTGCCTGTAAGG - Intergenic
1099080897 12:78178962-78178984 AGTTATATAACCTCCCTACTGGG - Intronic
1099406414 12:82268969-82268991 GAATATATAACCTCCCAGACTGG + Intronic
1100093953 12:91008287-91008309 CATTATATAACCTACCAGTAGGG + Intergenic
1101578868 12:106023581-106023603 GGTTATATGACCTTCCACCTGGG - Intergenic
1101701523 12:107178548-107178570 GGTGAGATAACCTCACAGCGAGG - Intergenic
1101747014 12:107550154-107550176 GGTTATATAGCCTCAAAGCCTGG - Intronic
1110346077 13:74449404-74449426 GATTAAATTACCTCCCACCAGGG + Intergenic
1116481500 14:45396660-45396682 GATTATATAACCTCTAAGCCAGG - Intergenic
1121545031 14:94756877-94756899 AGTTATATTAACTCACAGCATGG - Intergenic
1121589903 14:95096204-95096226 GGTTAAATAGCAGCCCAGCAGGG + Exonic
1144136136 17:12296909-12296931 GGTTTGATGACCTCCCACCAGGG - Intergenic
1144774931 17:17780618-17780640 GGTGATGTCACCTCCCAGAAGGG + Intronic
1148156776 17:45429230-45429252 GGTTATATAACCTCCCAGCAGGG + Intronic
1150388489 17:64778017-64778039 GGTTACATAACCTCCCAGCAGGG + Intergenic
1150790972 17:68199937-68199959 GGTCACATAACCTCCCAGCAGGG - Intergenic
1153990198 18:10390285-10390307 TGGTATAAAAACTCCCAGCACGG - Intergenic
1155356224 18:24956720-24956742 GGTGAGATAACCTCAGAGCATGG + Intergenic
1166412107 19:42562183-42562205 GGTTGGATTTCCTCCCAGCAAGG + Intergenic
1166532275 19:43550191-43550213 TGTTACATAAACTCCCAGGAGGG + Intronic
926956061 2:18301671-18301693 GGTTATACCATCTCTCAGCAGGG + Intronic
932599539 2:73113696-73113718 AGTTATTTAACCCCCCACCAGGG - Intronic
936551853 2:113450604-113450626 GGTTATGTATCCTTCCAGAATGG + Intronic
942869496 2:180717757-180717779 GGTGATCTTACCTCCCAGGAAGG + Intergenic
944524014 2:200599739-200599761 GCATATATAACCTACCACCAAGG - Exonic
946445635 2:219737744-219737766 GGTTATAAATACTCCCACCAAGG - Intergenic
1170386283 20:15820702-15820724 GCTAAGAAAACCTCCCAGCAAGG + Intronic
1174634123 20:51984219-51984241 GGTTATAAAACCTCACTGGATGG + Intergenic
1174770662 20:53297068-53297090 GGTGATATGACTTGCCAGCATGG - Intronic
1179492694 21:41751681-41751703 GGTTATGCAACCTGCCAGCTGGG + Intronic
1184629743 22:45766624-45766646 CGTTATATAACCTCCGAGTCTGG + Intronic
951869981 3:27350874-27350896 GGATGTATAACCTCCTAGCCAGG - Intronic
952568749 3:34687608-34687630 GGTTATAAATACTCCAAGCATGG - Intergenic
953036242 3:39213632-39213654 GGTTACATAACTTGCTAGCAGGG - Intergenic
955803790 3:62713025-62713047 GATTATATAGCCTTGCAGCATGG + Intronic
956823640 3:72976573-72976595 GGTTTTATCACCTCACTGCAAGG + Exonic
958870232 3:99550060-99550082 GGTTATACAAAGTCCCAGCTTGG - Intergenic
960445097 3:117738486-117738508 GGTTAAATAACTTTTCAGCATGG - Intergenic
960465659 3:117994170-117994192 GGTTATATAATGGCCCAGCCAGG - Intergenic
962342338 3:134596146-134596168 GGTTATATAATCTTCAAACAGGG + Intergenic
963793288 3:149605947-149605969 TGAAATATAACCTCCCAACATGG + Intronic
967774650 3:193374160-193374182 GATTATTTTTCCTCCCAGCAGGG + Intronic
980630793 4:135429749-135429771 GCTTATCTAACCTCCTAGAAAGG - Intergenic
985349288 4:189040327-189040349 TGATGTATCACCTCCCAGCATGG - Intergenic
993244935 5:85439001-85439023 GTTTATAGAAAATCCCAGCATGG + Intergenic
1000042960 5:157498757-157498779 TATTACATAACCCCCCAGCAAGG + Intronic
1001420129 5:171579825-171579847 GGTTATACAGCTTCCCAGCTGGG + Intergenic
1003100751 6:3174729-3174751 GGCTGTATAACTTCCCATCAGGG - Intergenic
1003237341 6:4307792-4307814 GTGTATATCACATCCCAGCAGGG + Intergenic
1003849868 6:10210496-10210518 GTTTACATAACCACCTAGCATGG - Intronic
1010003565 6:70971947-70971969 GTTTAGAAAACCTCCCAGCCAGG - Intergenic
1013760088 6:113508061-113508083 GGTGATATATCCTCCAAGTATGG + Intergenic
1018791269 6:167149879-167149901 GTGTATATATACTCCCAGCATGG - Intronic
1028103585 7:86850810-86850832 GGTTATCTAACCCCACAACATGG - Intronic
1030266499 7:107627350-107627372 GGGTATATAACCCCCCAAAAGGG - Intronic
1037918066 8:22784837-22784859 GGTTATGTAACCTCGAAGGAAGG - Intronic
1038207343 8:25479253-25479275 GATTATAAAATCTCACAGCAGGG - Intronic
1045502340 8:102753167-102753189 GGCTCTTTAACCTCTCAGCAAGG - Intergenic
1049901148 9:166550-166572 GGTTATGTATCCTTCCAGAATGG - Intronic
1052260650 9:26512680-26512702 AGTTATAAATCCTCCAAGCAAGG - Intergenic
1053744187 9:41176865-41176887 GGTTATGTATCCTTCCAGAATGG - Intronic
1054349463 9:64006672-64006694 GGTTATGTATCCTTCCAGAATGG - Intergenic
1054483086 9:65688428-65688450 GGTTATGTATCCTTCCAGAATGG + Intronic
1054684157 9:68254388-68254410 GGTTATGTATCCTTCCAGAATGG + Intronic
1056956961 9:91090367-91090389 GGTTATATGACCTGGCAACAGGG - Intergenic
1057952326 9:99379449-99379471 GGTTATGTAACATACCAGCCTGG + Intergenic
1058675151 9:107393903-107393925 GGTTGTACATCCTTCCAGCAAGG + Intergenic
1187430238 X:19216622-19216644 GGTAATATAAGCTCCTAACAAGG + Intergenic
1193153619 X:78149481-78149503 GGTTATATCATCTCCAAACAAGG + Intergenic
1198626080 X:138576506-138576528 GGTAATATAACCTGCCAAAAAGG - Intergenic