ID: 1148156907

View in Genome Browser
Species Human (GRCh38)
Location 17:45429875-45429897
Sequence CAGGCTGCTGCGCTGGGTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 2, 1: 1, 2: 1, 3: 23, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148156898_1148156907 10 Left 1148156898 17:45429842-45429864 CCGCAGGTACAGGCAGGCTGGCA 0: 1
1: 1
2: 2
3: 28
4: 290
Right 1148156907 17:45429875-45429897 CAGGCTGCTGCGCTGGGTCGCGG 0: 2
1: 1
2: 1
3: 23
4: 215
1148156895_1148156907 17 Left 1148156895 17:45429835-45429857 CCGCGGGCCGCAGGTACAGGCAG 0: 1
1: 1
2: 0
3: 4
4: 117
Right 1148156907 17:45429875-45429897 CAGGCTGCTGCGCTGGGTCGCGG 0: 2
1: 1
2: 1
3: 23
4: 215
1148156892_1148156907 28 Left 1148156892 17:45429824-45429846 CCGCACGGGCGCCGCGGGCCGCA 0: 1
1: 1
2: 0
3: 18
4: 114
Right 1148156907 17:45429875-45429897 CAGGCTGCTGCGCTGGGTCGCGG 0: 2
1: 1
2: 1
3: 23
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148156907 Original CRISPR CAGGCTGCTGCGCTGGGTCG CGG Intronic
900136878 1:1121525-1121547 CAGGCTGCTGCCCTGCAACGAGG + Intergenic
900252847 1:1680373-1680395 CATGCAGCTGCGCTGGGACGCGG + Intronic
900338461 1:2176326-2176348 AAGGCTGCGCCGCTTGGTCGTGG + Intronic
900531431 1:3155318-3155340 CAGGCTGCAGGGCTTGGCCGCGG + Intronic
900603081 1:3511483-3511505 CCCGCTGCTGCCCTGGGTCTGGG - Intronic
900603736 1:3514789-3514811 CAGGCTGATGGGCTGGGCAGCGG + Intronic
900811000 1:4801296-4801318 CAGGCTGTTGGGATGGGTCAAGG + Intergenic
900986166 1:6073864-6073886 GAGGCTGCTGCGCTGGCTCCCGG - Intronic
901632163 1:10653291-10653313 CAGGCTGCAGAGCAGAGTCGGGG - Intronic
901842597 1:11963591-11963613 CAGGCTGTTGGGCTCGGTCAGGG - Exonic
902437724 1:16409219-16409241 CCGGATGTTGCCCTGGGTCGGGG - Intronic
902514950 1:16985103-16985125 CAGGATGCTGGGGTGGGACGGGG + Intergenic
903035957 1:20492719-20492741 CAGGGTGCTGCACTGGTTCTTGG - Intergenic
904873557 1:33636409-33636431 CAGGATGCAGCTCAGGGTCGAGG + Exonic
905631671 1:39522218-39522240 CAGGCTTTTGAGCTGGGTCATGG + Intronic
905666082 1:39763954-39763976 CAGGCTTCTGAGCTGGGTCATGG - Intronic
907524509 1:55046406-55046428 GAGGCTGCTGGGCTGGGATGTGG + Intronic
911039666 1:93582015-93582037 CAGGCTGCTGCCGGGGGTGGGGG - Intronic
913163907 1:116168243-116168265 CACTGTGCTGCGGTGGGTCGGGG + Intergenic
914095339 1:144540035-144540057 CAGGCTGCCTCACTGGGTCAAGG - Intergenic
914303187 1:146393861-146393883 CAGGCTGCCTCACTGGGTCAAGG + Intergenic
914754898 1:150557088-150557110 GAGGCTGCAGGGCTGGCTCGGGG + Intronic
915268575 1:154735649-154735671 GGGGCTGATGCGCTGGGTCACGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918786336 1:188769065-188769087 CAGGCTGCTGTGCTGGCCAGTGG - Intergenic
921918674 1:220642195-220642217 CAGGCTGCTGTGCTGGCCAGTGG - Intronic
923347259 1:233066557-233066579 CAGGCTGCTGCAGTGGGGCTGGG - Intronic
923445438 1:234066459-234066481 CAGGCTGCAGCGGTGAGTCCAGG + Intronic
924929082 1:248711676-248711698 CATGCTGCAGCCCTGGGTCCTGG - Intergenic
1063172973 10:3526328-3526350 CAGGGTGCTGCGGAGGGTGGGGG - Intergenic
1064691972 10:17927613-17927635 CAGGCAGCTTGGCTGGGTGGAGG - Intergenic
1065379678 10:25077315-25077337 CAGGCTGATGAGCTGGCACGTGG - Intergenic
1067560196 10:47300093-47300115 CCGGCTGCGGGGCTGGGTCTCGG + Intergenic
1068303716 10:55177446-55177468 CAGGCTGCTGGACTGGATCTTGG - Intronic
1069842190 10:71346856-71346878 CAGGCTGCTGCGATGGAAGGGGG + Intronic
1069910779 10:71757824-71757846 CATTCTGCTGCGCTGGGGGGTGG + Intronic
1074830164 10:117241959-117241981 CAGGCTGCCGCGCCGGGGCTAGG + Intronic
1075985088 10:126778298-126778320 CAGGCTGCTGATCTGGGAAGTGG + Intergenic
1076220407 10:128729212-128729234 CAGGAGGCTGGGCTGGGTCCTGG - Intergenic
1076735568 10:132457532-132457554 CCGGCTGCTGAGGTGGGTTGGGG - Intergenic
1077418383 11:2436542-2436564 CAGGCTGCTGCCCTGGGCAGGGG + Intergenic
1078653418 11:13216490-13216512 CAGGCTGCAGTGCTGGGTTTGGG + Intergenic
1081621810 11:44623153-44623175 CAGGTTGCTACGCTGCCTCGGGG + Intergenic
1083062782 11:59891887-59891909 CAGGCTGCTGTGCTGGCCAGTGG + Intergenic
1083334897 11:61916824-61916846 CAGGCTGCGGGGCCGGGGCGGGG + Intronic
1084174775 11:67417507-67417529 CAGGCTGCTTCCCTGGCTCCTGG + Exonic
1084664555 11:70569439-70569461 TAGGCTGCTGTGCTGGGCAGAGG + Intronic
1084887557 11:72221072-72221094 CAGTCTGCTGGGGTGGGTGGGGG - Intronic
1088008311 11:104969147-104969169 CAGGCTGCTATGCTGGCTAGTGG - Exonic
1089456702 11:118629953-118629975 CAGGCTGCTTATCTGGGTCCTGG + Intronic
1091407813 12:220153-220175 CAACCTGCTGCACTGGGGCGTGG + Intergenic
1094273802 12:28646031-28646053 CAGGCTGCTGTGCTGGCCCGCGG + Intergenic
1096468836 12:51863982-51864004 CAGGCAGCTCCGCTGCGTCTCGG - Intergenic
1096637925 12:52973143-52973165 CAGGCTGCTGCACTGGGATGAGG - Intergenic
1101963201 12:109265238-109265260 CATGCTGCGTCGCTGGTTCGTGG + Exonic
1102574172 12:113845343-113845365 CAGGCTGCTGAGCTGGGGGTGGG - Intronic
1104094562 12:125545142-125545164 CAGGCTGCTGAACTGGGTCAAGG + Intronic
1105492608 13:20902931-20902953 CCGGCCGCCGCGCTGGGGCGGGG + Intronic
1106091511 13:26599418-26599440 CAGGCTGCTGCTCTGCATCTAGG + Intronic
1106421468 13:29589497-29589519 GGGGCAGCTGCGCTGGGACGTGG - Intronic
1112331223 13:98478358-98478380 CAGGCTGCTGCTCAGAGTCTGGG - Intronic
1112507888 13:99985712-99985734 AGGGCTGCTGCGCTGGGGTGGGG - Exonic
1116312354 14:43342563-43342585 CAGGCTGCTGTGCTGGCCAGCGG + Intergenic
1117043347 14:51787704-51787726 GAGGCAGCTGAGCTGTGTCGGGG + Intergenic
1122642596 14:103169035-103169057 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1122959445 14:105087742-105087764 CAGGCTGGGGCGCTGGCGCGGGG + Intergenic
1123031937 14:105456067-105456089 GAGGCCGCTGTGCTGGGTCTGGG + Intronic
1123038132 14:105479554-105479576 GAGGCCGCTGGGGTGGGTCGGGG - Intronic
1129723576 15:77890645-77890667 CAGTCTGCTGGGCTGGTTAGAGG + Intergenic
1130651480 15:85764439-85764461 TTGGCTGCTGCGCTGAGTCCGGG - Intronic
1132578622 16:675222-675244 CTTGCTGCTGCGCTCGGTGGGGG + Intronic
1132607264 16:798805-798827 CAGGCTGCTGAAGTGGATCGAGG - Exonic
1132618767 16:854753-854775 CAGGCTGAGGAGCCGGGTCGGGG - Intronic
1132628165 16:902205-902227 CCGGCTGCTGCGCTGGCCCAGGG - Intronic
1132711905 16:1272601-1272623 GAGGCTGCTGGGCTGTGACGGGG - Intergenic
1132842918 16:1987011-1987033 CTGGCTGCTGAGCTGGGATGAGG + Exonic
1135840112 16:25868470-25868492 CAGGCTGTTGCTCTGTGTCAAGG - Intronic
1135945225 16:26859226-26859248 CTGGCTGCTGCCCTGGGTGTGGG + Intergenic
1136547751 16:30965184-30965206 CAGGCTGCTGTGCTGGGCGAAGG - Exonic
1140778137 16:78269124-78269146 CAAGCTGCTCCTCTGGGTTGTGG - Intronic
1141834968 16:86532415-86532437 CAGCCTGCTGCTCTCGGGCGCGG + Exonic
1142275465 16:89116440-89116462 CTGGCTGCTGGGCTGGGAGGAGG + Intronic
1142702924 17:1675208-1675230 CAGGCTGCTGCGCCTCATCGTGG - Exonic
1142721238 17:1777305-1777327 CAGGCTGCAGCCCTGGGCTGGGG - Exonic
1144638192 17:16924151-16924173 CAGCCTGCTGCCCTGGGTTCTGG + Intergenic
1144754055 17:17668858-17668880 CCGGATGCTGGGCTGGGTAGGGG - Intergenic
1144946429 17:18971794-18971816 CAGGGTCCTGTGCTGGGGCGGGG - Intronic
1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG + Intergenic
1145281757 17:21473142-21473164 AAGGCTGCTGCTTTGGGTCTTGG + Intergenic
1145316612 17:21738909-21738931 CAGGCTTCTGCGCTTGGTGGTGG - Intergenic
1146747517 17:35345620-35345642 CAGGCGGCTGCGGAGGGGCGTGG - Intergenic
1148156907 17:45429875-45429897 CAGGCTGCTGCGCTGGGTCGCGG + Intronic
1150226930 17:63529388-63529410 CAGGCTGCTGCTCTGGGCCTAGG - Intronic
1150388611 17:64778649-64778671 CAGGCTGCTGCGCTGGCTCGCGG + Intergenic
1150790854 17:68199341-68199363 CAGGCTGCTGCGCTGGGTCGCGG - Intergenic
1151328705 17:73394250-73394272 CATGCTGGTGCGCTGGAGCGAGG - Exonic
1151344107 17:73491255-73491277 CAGGCTGCTTTGCTGGGCCAGGG - Intronic
1151477912 17:74354261-74354283 CAGGCTGCTGCGCTCTGTCGCGG - Exonic
1151983708 17:77528821-77528843 CAGGCTGCTGCGCGCGGGCTGGG + Intergenic
1152238464 17:79150201-79150223 GTGGCTGCTGCTCTAGGTCGTGG - Intronic
1157539280 18:48488144-48488166 CAGGTTGCTCCCCTGGGTCAGGG + Intergenic
1158283287 18:55851073-55851095 CAGGCTGCTGGGCTGGGCCCTGG - Intergenic
1158559582 18:58502854-58502876 CTGGCGGCTGCTCTGGGTGGGGG - Intronic
1160001430 18:75027941-75027963 CACGCTGCTGCACTGTGCCGTGG + Intronic
1160696083 19:485124-485146 CAGGGTCCTCCGCTGGGTTGAGG - Intergenic
1160722704 19:604408-604430 CAGGTTGCTGAGCAGGGTCGAGG + Intronic
1161114595 19:2489414-2489436 CAGGCGGCTCCGCCGGGGCGTGG - Intergenic
1161138581 19:2635093-2635115 CAGGCTGCTGAGCAGCGTCCCGG + Intronic
1161138758 19:2635985-2636007 CAGGCTGCTGAGCAGCGTCCCGG - Intronic
1162460677 19:10812193-10812215 AAGGCTGCTGCGCTGGGGGATGG + Intronic
1162902121 19:13801313-13801335 CAGGCTGCTGAGCTGGGGAATGG + Intronic
1163604205 19:18265253-18265275 CAGCCTGGTGCGCTGGGATGAGG + Exonic
1164982952 19:32627985-32628007 CTGGCTGATGGGCTGGGTGGGGG - Intronic
1165150456 19:33757069-33757091 CAGGGTGCTGGGCTGGGCGGAGG + Intronic
1166277309 19:41762901-41762923 CAGACTGCTGAGCTGTGTCCTGG + Intronic
1168316279 19:55486090-55486112 GAGGCTGCTGGGCTAGGTTGGGG - Intronic
1168344499 19:55643759-55643781 GAGGCTGCTGCACTGGGTACGGG + Intronic
925361328 2:3282575-3282597 CGGGCTGCTGCGCCGGCTCCTGG + Intronic
925669689 2:6297634-6297656 GGGGCTGCTGGGCTGGGTCAGGG + Intergenic
927206891 2:20616681-20616703 CAGGCTGCTGCTTAGGGTAGGGG - Intronic
927463989 2:23323570-23323592 CAGGAGGCAGAGCTGGGTCGGGG + Intergenic
928410811 2:31052559-31052581 CAGGCTGCTGCAGTGGGAAGGGG - Intronic
934759839 2:96848425-96848447 CAGGCTGCTGAGAGGGGTCACGG - Exonic
934765250 2:96876837-96876859 CACCCTGCTGGGCTGGCTCGGGG - Intronic
937288396 2:120767319-120767341 CAGGGTGCTGGGCTGGGTGCTGG + Intronic
937296408 2:120812343-120812365 CAGGCAGATGCCCTGGGTCCTGG + Intronic
938466822 2:131530226-131530248 CAGGATCCTGGGCTGGGTGGGGG - Intronic
941082478 2:161078001-161078023 CAGGGTGCTGCCCTGGGAGGAGG + Intergenic
941700478 2:168599189-168599211 TAGGCTGCTTCTCTGGGTGGAGG + Intronic
942547647 2:177081247-177081269 CACGCTGCTGCTCTGTGTCAAGG + Intergenic
943383008 2:187173670-187173692 CAGGCTGCTGGGCTGGACCCTGG + Intergenic
947535132 2:230935304-230935326 CAGGAGGCTGCGCTGGGGCTGGG - Intronic
948930922 2:241131630-241131652 CACCCTGCTGCCCTGGGTCAGGG - Intronic
1168845385 20:940992-941014 CAGGATGCTGCGGTGGGTGAAGG + Intergenic
1171448440 20:25220583-25220605 CAGGCTGCTCTGCTGGGGCGAGG - Intronic
1173245841 20:41336870-41336892 CTGGCTGCTGTGCTGGGCCTTGG - Intergenic
1175112230 20:56656730-56656752 CAGGCAGCTGGGCTGGCTGGTGG + Intergenic
1175174251 20:57101082-57101104 CAGGCAGATGTGCTGGGGCGGGG + Intergenic
1175299190 20:57930734-57930756 CAGGCAGATGCGCTGTGTGGCGG - Intergenic
1175413656 20:58787412-58787434 CAGGATGCTGAGCTGGGACTCGG + Intergenic
1175806433 20:61831707-61831729 CAGGCTCCTGGGCGGGGTGGGGG + Intronic
1175911877 20:62408869-62408891 CTGGCTGCAGCGCCGGGTCCTGG + Intergenic
1175989092 20:62778709-62778731 CAGCCTCATGCGCTGGGGCGGGG - Intergenic
1179539714 21:42076256-42076278 AGGGCTGCTGGGCTGGGGCGGGG + Intronic
1179545432 21:42110023-42110045 CAGGATGCAGCCCGGGGTCGAGG + Intronic
1179817171 21:43914101-43914123 CAGCCTGTTGCTCTGTGTCGTGG + Intronic
1180087189 21:45513046-45513068 CAGGCTGCTGTGCTTGGTGTTGG - Exonic
1180742970 22:18066598-18066620 CAGCCAGCTGTGCTGGGTCGAGG + Intergenic
1180854995 22:19040101-19040123 CAGGCTGCAGAGCAGGGTGGGGG - Intronic
1180988850 22:19921621-19921643 CAGCCTGCAGTGCTGGGTCCTGG - Intronic
1181433078 22:22894662-22894684 CAGGCTGCTGGGGTGGGCCTGGG + Intronic
1182782762 22:32881101-32881123 CAGGCTGCTGCTCGGGGAAGGGG + Intronic
1183186512 22:36294553-36294575 CAGCCTTCTGCCCTGGGTAGAGG + Intronic
1183324488 22:37184005-37184027 CAGGCTGCTGAGCTGGGCCCAGG + Intronic
1183732398 22:39625996-39626018 CAGGCTGTGGCGCAGGGGCGAGG + Intronic
1183862771 22:40681588-40681610 CCGGATGCTGCGCTGGGAGGCGG - Exonic
1185117052 22:48944001-48944023 CAGGCTGCTCAGCTGAGCCGGGG - Intergenic
1185199862 22:49494670-49494692 CAGGCTGCAGGCCTGGGGCGCGG + Intronic
1185399010 22:50606398-50606420 CAGGCTGCTGCGCTTGGCTCAGG - Intronic
950007962 3:9703751-9703773 CAGGCTGCTCCAATGGGGCGGGG + Intergenic
950221025 3:11196218-11196240 GAGGCTGCTGCGCAGGGCCAGGG - Intronic
950450046 3:13060376-13060398 CAGGCTCCTGCGGTGGGGCCCGG + Intronic
952967157 3:38628442-38628464 CAAGGTGCTGAGCTGGGTCGTGG - Intronic
954392834 3:50276352-50276374 CAGGCTGCGGCGCCGGGACTCGG + Exonic
962438100 3:135384863-135384885 CAGGCTGCTGGCCTGGGCCTGGG + Intergenic
962871125 3:139493986-139494008 CAGGATGCTGTGCTTGGTCTGGG - Intergenic
963236611 3:142963189-142963211 GCCGCTGCTGCGCTGGGACGAGG - Exonic
963642876 3:147880372-147880394 CAGGCTGCTGGGCTGGACCTTGG + Intergenic
963761232 3:149288836-149288858 CAGCCGGCTGCGCAGGGTCCTGG - Intergenic
967368168 3:188711661-188711683 CAGGCTGCTCTGCTAGGTGGTGG + Intronic
967934639 3:194717112-194717134 CTGGCTTCTGCTCGGGGTCGTGG + Intergenic
969268217 4:6080061-6080083 GATGCTGCTGAGCTGGGTCAGGG - Intronic
971859630 4:32087514-32087536 CAGGCTGCTGGGCTGGATCTTGG + Intergenic
975297375 4:72750239-72750261 CAGACTGTTGTGCTGGGTCTTGG - Intergenic
976078100 4:81321739-81321761 CAGCCTGCTGCGCTGGCCAGAGG - Intergenic
976206177 4:82625550-82625572 CAAGCTGCTGCGTGGGGTCGGGG - Intergenic
976293623 4:83447742-83447764 CTGGCTGCTGGGTGGGGTCGTGG + Intronic
986422657 5:7600043-7600065 CAGGTTCCTGTGCTGGGTCCTGG + Intronic
986729864 5:10627481-10627503 CAGGATGCTGCCCGGGGACGGGG + Intronic
989091336 5:37736192-37736214 CAGGCTGCTGGCCAGGGTCCAGG - Intronic
993365560 5:87030366-87030388 CAGGCTGCTGTGCTGGCCAGTGG + Intergenic
998148620 5:139744692-139744714 CAGGAGGCTGGGCTGGGTCTGGG - Intergenic
998303687 5:141052067-141052089 CAGGCTGCTCCTCTCGGTCCAGG - Exonic
999261119 5:150239486-150239508 CAGCCTGCTGGTCTGGGCCGTGG + Intronic
1001965730 5:175908641-175908663 CCGGCTGCTGTGCTGGGGCAGGG + Intergenic
1002251215 5:177930555-177930577 CCGGCTGCTGTGCTGGGGCAGGG - Intergenic
1002644559 5:180646762-180646784 CAGGCTCCTTCCCTGGGTCGGGG + Intronic
1002864358 6:1107944-1107966 CAGGCTGCTTAGATGGGTCCTGG + Intergenic
1002896947 6:1384854-1384876 CAGGCCGCTGGGCTGGCTCCTGG + Intergenic
1003096250 6:3145431-3145453 CAGGGTGGAGCGCTGGTTCGGGG + Intronic
1003097915 6:3156879-3156901 CAGGTGACTGCGCTGGGTGGGGG - Intronic
1003569720 6:7247940-7247962 GAGCCGACTGCGCTGGGTCGGGG - Intronic
1007400824 6:41601329-41601351 CAGGCTGGTGTGCTGGGGCTGGG - Exonic
1009490122 6:64279728-64279750 CAGGCTGCTTCTCTGTGTGGTGG - Intronic
1011492741 6:87909280-87909302 CAGGCTTCAGCTCTGGGTGGAGG + Intergenic
1012475742 6:99613616-99613638 CAGGCTGCTGGGCGGGGGCCGGG + Exonic
1013349715 6:109294198-109294220 AGGGCTGCTGCCCTGGGGCGTGG + Intergenic
1015859945 6:137665353-137665375 GAGGCTGCTTCACTGGGTCAAGG + Intergenic
1016183513 6:141175180-141175202 CAGCCAGCTGCGCTGAGTCTGGG - Intergenic
1016901654 6:149108789-149108811 CAGGCTGCTGAGGTGGGAGGTGG - Intergenic
1017527730 6:155256827-155256849 CAGGCTGCTGCTCAGCCTCGGGG - Exonic
1019043097 6:169122259-169122281 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1019292810 7:258573-258595 CAGGCTGCTGGGCTGGGAGCTGG - Intronic
1019361984 7:609397-609419 CAGGGTCCTGAGCTGGGTGGTGG - Intronic
1019379214 7:712439-712461 GAGGCGGCTGCGCGGGGACGCGG + Intronic
1019739971 7:2667896-2667918 CTGGCTGCTGCACTGGGAAGGGG + Intergenic
1019995517 7:4722053-4722075 GAGGCTGCTGGGATGGGTGGAGG - Intronic
1020009759 7:4801596-4801618 CAGGGTGCTGTGCGGGGTCTGGG + Intronic
1022802082 7:33786357-33786379 CAGGCTGCTGAGATGGATGGAGG + Intergenic
1023050572 7:36247676-36247698 CAGTCTGCTGTGATGGGTCCTGG - Intronic
1023863585 7:44228674-44228696 CAGGCTGCGGCGCCGGGGCAGGG + Intronic
1030084121 7:105802773-105802795 CAGGCTGCTGTGCAGGGTGCTGG - Intronic
1032847245 7:135762125-135762147 TAGGCTGGTGGGCTGGGCCGGGG - Intergenic
1033477163 7:141702108-141702130 GCCGCTGCTGCGCTGGGCCGAGG - Exonic
1035810169 8:2484963-2484985 CAGGCGGGGGTGCTGGGTCGCGG - Intergenic
1036561581 8:9903910-9903932 TGGGTTGCTGCGCTGGGGCGAGG - Intergenic
1037809326 8:22077251-22077273 GAGGTTGCTGGGCTGGGTGGTGG + Intronic
1039942676 8:42104559-42104581 CAGGCTTCTGCTCTGGCTGGTGG - Intergenic
1041625122 8:60016426-60016448 CAGGCTGGTGAGCTGGCTCTTGG - Intergenic
1043147728 8:76678090-76678112 CTGGCTGCTCCGCTGTGCCGCGG - Intergenic
1050444070 9:5699384-5699406 CAAGCTGCTGGGATGGGCCGTGG + Intronic
1055969838 9:81900684-81900706 CAGGCTGCTGAGCTGAGAGGAGG - Intergenic
1056020982 9:82438086-82438108 CAGGCTGCTGCACTTGCTGGAGG - Intergenic
1056715115 9:89022166-89022188 CAGGTTCCTGCCCTGGGTCTTGG - Intronic
1057036047 9:91812381-91812403 CAGGCTCCTGCGCGGGGGCCGGG + Intronic
1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG + Intronic
1057197880 9:93125100-93125122 CAGGCTGGGGCGCTGCGTCTGGG - Intronic
1059550246 9:115221960-115221982 CAGGCTGCTACCCTGGGTGAGGG + Intronic
1060952660 9:127613330-127613352 CAGACTGCGGCGCTGGGCGGCGG - Intronic
1060974224 9:127755139-127755161 CAGGCTGCACCGCTCGGTCATGG + Intronic
1062139390 9:134947559-134947581 CAGGCTGCTGGGGTGGGGAGGGG - Intergenic
1062457689 9:136647160-136647182 CGGTCTGCTGAGCTGGGTGGAGG + Intergenic
1062488723 9:136793807-136793829 GTGGCAGCTGAGCTGGGTCGGGG - Intronic
1185877747 X:3713727-3713749 CCGGCTCCTGGGCTGGGTCGGGG - Intergenic
1185894294 X:3843985-3844007 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1185899413 X:3882409-3882431 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1185904530 X:3920838-3920860 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1187124025 X:16436584-16436606 CTGGCTGCTGCGCTAGGAGGGGG + Intergenic
1190329383 X:49226371-49226393 CTGGCTTCTGGGCTGGGTCAGGG + Intronic
1192944421 X:75949923-75949945 CAGCCTGCTGCGCTGGCCGGTGG + Intergenic
1195721671 X:107874494-107874516 CAGGCTGCTGGGCTGGACCAGGG + Intronic
1200136020 X:153875222-153875244 AAGGCTGCTGGGCTGGGACCAGG + Intronic