ID: 1148157089

View in Genome Browser
Species Human (GRCh38)
Location 17:45430757-45430779
Sequence GACCCTCTGCTGATTCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148157089_1148157094 22 Left 1148157089 17:45430757-45430779 CCGCAGAGAATCAGCAGAGGGTC 0: 1
1: 0
2: 1
3: 7
4: 174
Right 1148157094 17:45430802-45430824 CAGCTTGCGCCCCGACCCCCTGG 0: 1
1: 0
2: 2
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148157089 Original CRISPR GACCCTCTGCTGATTCTCTG CGG (reversed) Intronic
901881151 1:12194484-12194506 GCCTCTCTGCTGGTTCTATGGGG + Intronic
903768326 1:25748827-25748849 GGCCCTTTCCTGGTTCTCTGAGG - Intronic
904459887 1:30670190-30670212 GACCCTTTGCTAATTATCAGAGG - Intergenic
906047116 1:42839834-42839856 GATCCTCTGCAGTATCTCTGGGG + Intronic
907162500 1:52381555-52381577 GGCCCTATGCTGGTGCTCTGAGG - Intronic
907313382 1:53552541-53552563 GACCCTCTGGTTTTCCTCTGGGG + Intronic
909584105 1:77270177-77270199 GACTCTCTGCTGTATCTCTTGGG + Intergenic
910100016 1:83565684-83565706 GGCCCTCTCCTGGTTCTCTGTGG + Intergenic
910212132 1:84804250-84804272 TACCCTCTGCTAATGATCTGGGG + Intergenic
910393654 1:86769994-86770016 GACCCTCAGCTGATTGGATGAGG + Intergenic
912209645 1:107544130-107544152 GACCCTCTGCTTATTTCCTGAGG + Intergenic
913233261 1:116759683-116759705 GATCCTTTTCTGATGCTCTGAGG + Intronic
917165039 1:172102481-172102503 GAACATCTGCTTATTTTCTGGGG - Intronic
917724383 1:177815039-177815061 GTCTCTCTGCAGACTCTCTGAGG - Intergenic
920639935 1:207742267-207742289 GACACATTGCTGGTTCTCTGTGG + Intergenic
921310050 1:213833580-213833602 GACCCTCTGCTGAATGAGTGTGG - Intergenic
1068858790 10:61825213-61825235 GACCCTGTGCTGCATGTCTGTGG - Intergenic
1069623024 10:69849439-69849461 GCCCCTCTGCTCTGTCTCTGGGG + Intronic
1069905880 10:71731827-71731849 CATCCTCTGCTGCATCTCTGAGG + Intronic
1072550231 10:96471686-96471708 GGCTCTGTACTGATTCTCTGTGG - Intronic
1073741177 10:106408820-106408842 GATTCTCTGCAGATCCTCTGGGG - Intergenic
1075312035 10:121422353-121422375 GAACTTCTGGTGATTCACTGGGG - Intergenic
1075640004 10:124057662-124057684 GTTCTTCTGCAGATTCTCTGGGG - Intronic
1077018257 11:406411-406433 GACCCCATGCTGATTCTTCGAGG - Exonic
1081964700 11:47162366-47162388 GCCCCTCTGCTCGTTGTCTGAGG - Intronic
1082676427 11:56110450-56110472 GACCTTCCCCTGATTTTCTGTGG - Intergenic
1083261064 11:61523422-61523444 GTCCATCTGCTGATTCTCCCAGG - Intronic
1085199527 11:74693316-74693338 GACCCTTTGCTGATGCTCTGGGG + Intergenic
1085767389 11:79295062-79295084 GTACCTCTGCTGCTTCTCAGAGG - Intronic
1088452272 11:109994902-109994924 GATCTTCTCATGATTCTCTGTGG - Intergenic
1088847338 11:113679746-113679768 GTCCCTGGGCTCATTCTCTGCGG - Intergenic
1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG + Intronic
1091309856 11:134564697-134564719 GACCCTCTGCTGTGCCTCTGTGG + Intergenic
1091582412 12:1797622-1797644 GACCCTCTGCAAATGCACTGGGG - Intronic
1094174072 12:27524087-27524109 GCCCCACTGCTGACTCTCTTTGG + Intronic
1095975886 12:47940980-47941002 TACCCTCTGCTGTGTTTCTGTGG - Intronic
1096045156 12:48555837-48555859 GACACATTGCTGGTTCTCTGTGG - Intergenic
1096799359 12:54099383-54099405 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1097685803 12:62689806-62689828 GACCCTCTGCTTATACTCCTAGG - Exonic
1100176331 12:92035111-92035133 GAACATCTGCTGATTCCCTTGGG + Intronic
1100852631 12:98729134-98729156 AAGCCTCTGCTAACTCTCTGAGG - Intronic
1101884857 12:108653782-108653804 AACCCTCTGGAGAGTCTCTGAGG + Intronic
1104069866 12:125335334-125335356 GACCCCATGATGATTCTTTGGGG + Intronic
1104293672 12:127492444-127492466 GTCCTTCTCCTTATTCTCTGGGG + Intergenic
1105250375 13:18693773-18693795 AACCTTGTGGTGATTCTCTGAGG + Intergenic
1108171857 13:47750206-47750228 TACCCTGTGCTCATTCTCAGAGG + Intergenic
1108463866 13:50695036-50695058 GATCCTGAGCTGATTCTCTTGGG - Intronic
1109325172 13:60858883-60858905 GACCTTCTGTTAATTTTCTGAGG + Intergenic
1112245516 13:97729931-97729953 GACTGTCTGCTGACTCACTGGGG + Intergenic
1114243531 14:20891581-20891603 GCCCCTCTGCTGCCACTCTGGGG - Intronic
1117958598 14:61141931-61141953 TGCCCTCTGCTCATTCTCTTTGG - Intergenic
1118630076 14:67694930-67694952 AGCCCGCTGCTGATTCACTGGGG + Intronic
1118800310 14:69183638-69183660 GAACCTTTGGTGGTTCTCTGGGG + Intergenic
1120607844 14:86601935-86601957 AATCCTCTGCTATTTCTCTGGGG + Intergenic
1121548543 14:94780791-94780813 GAGCCTGTGCTGTTTCCCTGTGG + Intergenic
1123167827 14:106343406-106343428 CAATCTCTGCTCATTCTCTGGGG + Intergenic
1123170456 14:106368117-106368139 CAATCTCTGCTCATTCTCTGGGG + Intergenic
1125613841 15:40992146-40992168 GAACCTCCGCTTATTCTCTTGGG - Intronic
1126105082 15:45142090-45142112 GACCCTCTGTTGCTTCCCTTTGG + Exonic
1126669501 15:51103229-51103251 AAGCCTTTGCTCATTCTCTGAGG + Intronic
1130229654 15:82086966-82086988 GAACCACTGTTGATTCTCTAGGG - Intergenic
1131051685 15:89352420-89352442 TACCCACTGCTTATTTTCTGTGG - Intergenic
1133184442 16:4085550-4085572 GACCCTCTGCTGCAGCTCTTGGG - Intronic
1134106586 16:11489697-11489719 GCCCCTCAGCTGATCCCCTGAGG + Intronic
1137540653 16:49359473-49359495 GACCCTCCACTGATTGGCTGTGG + Intergenic
1137717675 16:50608638-50608660 GAAACTCTGCTGCTCCTCTGGGG + Intronic
1140410502 16:74738052-74738074 CTCCCTGTGCTGATTTTCTGGGG + Intronic
1141198514 16:81879507-81879529 GACTCTCTGATGCTTCTCAGAGG + Intronic
1141540524 16:84717037-84717059 GACCCGCAGCTGATTCTCAACGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143854629 17:9839552-9839574 CACCCTCTGCTGCTTCTCCATGG + Intronic
1144074376 17:11703759-11703781 GAGCCACTGCTGATCATCTGTGG - Intronic
1147728213 17:42579998-42580020 AACCCTTTGCTGATCCTCAGGGG - Exonic
1148157089 17:45430757-45430779 GACCCTCTGCTGATTCTCTGCGG - Intronic
1148646748 17:49223779-49223801 GACCCTCTTCTGCCTCTGTGGGG + Exonic
1150790667 17:68198422-68198444 GGGACTCTGCGGATTCTCTGCGG + Intergenic
1151484268 17:74388768-74388790 AACCCTCTGTTGCCTCTCTGAGG + Intergenic
1151799396 17:76368833-76368855 ATCCCTGTGCTGATTCTGTGAGG - Intronic
1153046294 18:858159-858181 GATCCTCTGTGGCTTCTCTGGGG - Intergenic
1154438469 18:14365153-14365175 AACCTTGTGGTGATTCTCTGAGG - Intergenic
1160868890 19:1268127-1268149 GACCCTCTGCTGACAAGCTGGGG - Intronic
1163796530 19:19341285-19341307 CACCCGCTGCTGACCCTCTGCGG + Exonic
1163845297 19:19635161-19635183 GAGACTCTCCTGATCCTCTGTGG - Exonic
1166288965 19:41849624-41849646 GCCCCTCTCCTGGGTCTCTGAGG - Intronic
1166785642 19:45365041-45365063 GCCCCACTGCCGATTCTATGAGG - Exonic
926923041 2:17958247-17958269 GTCTCACTGCTGAGTCTCTGTGG + Intronic
927520081 2:23693263-23693285 GGCCGTCAGCTGCTTCTCTGGGG - Exonic
928554816 2:32412703-32412725 CATCCTCTGCTGATTATCAGTGG - Intronic
930172418 2:48265257-48265279 GACCCCCTTCTCCTTCTCTGAGG - Intergenic
931164023 2:59725872-59725894 GACCCTCTGAGGACTCTCTGAGG - Intergenic
932852457 2:75200218-75200240 GAGCCTCTGCTCAATCACTGGGG + Intergenic
936022738 2:109007151-109007173 GGCCCTTTCCTGAGTCTCTGCGG - Intergenic
936595956 2:113848066-113848088 GACACTCTCATGAATCTCTGTGG - Intergenic
937293997 2:120798865-120798887 GCCCCTCTGCCCATGCTCTGAGG + Intronic
938957928 2:136315699-136315721 GTCCCACTGGGGATTCTCTGAGG - Intergenic
939046990 2:137261279-137261301 GACCCTCTGCTCAGTCTCAAAGG + Intronic
940114518 2:150193061-150193083 GACCCTCTGCTGCAGGTCTGTGG - Intergenic
940235231 2:151504507-151504529 CACTCTCTGCTTATACTCTGTGG - Intronic
941442186 2:165552390-165552412 CACCCTATACTGATTGTCTGAGG - Intronic
942038128 2:172031318-172031340 TACCCTCTGCTCTTCCTCTGGGG - Intronic
944308769 2:198208404-198208426 GAACCTCTTCTGATTCTAAGTGG - Intronic
947310525 2:228796775-228796797 GATCCTCTGCTCAATGTCTGAGG + Intergenic
947923445 2:233899962-233899984 GACATTCTGCTGAGGCTCTGTGG - Intergenic
948578877 2:238970916-238970938 CACCCTCTGCTTGGTCTCTGGGG + Intergenic
1168956166 20:1835943-1835965 CACCCACTTCTCATTCTCTGGGG + Intergenic
1169928183 20:10804521-10804543 GACCCTGTGTTAATTTTCTGTGG - Intergenic
1171437252 20:25133244-25133266 GACCCTCTGAACATTCTCTTGGG + Intergenic
1171797072 20:29574957-29574979 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1171851178 20:30309207-30309229 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1172194102 20:33080296-33080318 TGCCCTGTGCTGACTCTCTGAGG + Intronic
1173873160 20:46354213-46354235 CACCCTCTGCTGATCCTGCGTGG + Intronic
1176457206 21:6924319-6924341 AACCTTGTGGTGATTCTCTGAGG + Intergenic
1176835379 21:13789403-13789425 AACCTTGTGGTGATTCTCTGAGG + Intergenic
1179536421 21:42055652-42055674 CTCCCTCTCCTGATTCACTGGGG + Intergenic
1180166537 21:46033617-46033639 GACCCCGTGCTGCCTCTCTGTGG - Intergenic
1181431606 22:22884943-22884965 GACCCCCTGCTGAGGGTCTGTGG - Intronic
1182659096 22:31912536-31912558 GACTATGTGCTGATTCACTGAGG - Intergenic
1184890584 22:47376517-47376539 GAGCCTCAGCTGCTTCCCTGCGG - Intergenic
1185241895 22:49751076-49751098 GACCTTCATCTGAGTCTCTGAGG - Intergenic
1185292671 22:50035034-50035056 CACCCTCTCCTTATTCCCTGTGG - Intronic
953852897 3:46479370-46479392 GACCATCTGCTTTTACTCTGAGG + Intronic
955546079 3:60031763-60031785 CACCCTCTGCTAAGCCTCTGTGG - Intronic
955780122 3:62475807-62475829 GTCCCTGTGCTGATCTTCTGAGG + Intronic
959893241 3:111580073-111580095 GAACTTCTGCAGTTTCTCTGGGG - Intronic
960952312 3:123007298-123007320 GACCCTCCCCTCATTCTCTAGGG + Intronic
961319301 3:126061835-126061857 GAACCTCTGCTGTCTCTCTTGGG + Intronic
961774958 3:129278320-129278342 GCCCCTCAGCTGAATCTCTAAGG - Intergenic
963393807 3:144705570-144705592 GACCCTATGATGTTACTCTGAGG - Intergenic
964245865 3:154652678-154652700 GACCCTCTTTTGATTCTATCTGG + Intergenic
964976890 3:162632913-162632935 GATTCTCTGCTGATGCTCTCAGG + Intergenic
967552149 3:190809160-190809182 GCCTCTCTGCTGACTCTGTGGGG - Intergenic
968500032 4:945571-945593 GAGCCTCTGTCCATTCTCTGGGG + Intronic
972735354 4:41835469-41835491 GACCATCTGCTGAATGTCTGTGG - Intergenic
973884131 4:55303633-55303655 TACCTTCTTCTAATTCTCTGGGG + Intergenic
975184017 4:71380126-71380148 GAAGCTCTGCTGCTTTTCTGTGG + Intronic
978773996 4:112487384-112487406 GAGTCTTAGCTGATTCTCTGGGG + Intergenic
980742221 4:136966588-136966610 GACCTTCTGCTCATTCTTTTTGG + Intergenic
980826735 4:138082168-138082190 GACCAGCTGGAGATTCTCTGAGG + Intergenic
986868115 5:12014027-12014049 GATCCTATGATGATTCTCTTTGG - Intergenic
992833086 5:80614600-80614622 GACTCTCTGCAGAGTCCCTGAGG + Intergenic
998181822 5:139951436-139951458 CACCCCCTGCTGCCTCTCTGGGG + Intronic
998462212 5:142318077-142318099 GAGCCTCTGCTGAATTTATGTGG + Intronic
998529099 5:142868692-142868714 GGCCCTCGGCTGGCTCTCTGGGG + Intronic
999386695 5:151158495-151158517 GCCCCCCTGCTGATCCTCGGAGG - Intergenic
999705095 5:154265212-154265234 GACACCCTGCTGATTGTCTGGGG - Intronic
1001236386 5:170032942-170032964 CACGCTCTGGTGTTTCTCTGTGG + Intronic
1005292312 6:24391912-24391934 GTCCCTCTGCTGTTTCCCTTGGG - Intergenic
1007193544 6:40039957-40039979 GAGCCTCAGCTGATCCTGTGGGG - Intergenic
1015989561 6:138923016-138923038 AACCCTGTCCAGATTCTCTGTGG - Intronic
1016881959 6:148920428-148920450 CACCCTCTTCTGATGCCCTGAGG + Intronic
1020701687 7:11492036-11492058 CACCCTCTAATGATTCTCTGTGG + Intronic
1028312310 7:89354258-89354280 GAAGCTCTGCTGATTCTCCCAGG + Intergenic
1028641382 7:93045531-93045553 GAACTTCTGCTGATTATCAGTGG - Intergenic
1030296624 7:107935174-107935196 TCCCCTCTTCTGTTTCTCTGTGG - Intronic
1035201363 7:157268889-157268911 GACCCTTTGCTGATGCTGGGGGG + Exonic
1035370238 7:158375242-158375264 AGCCCTCTGCTGATGCCCTGTGG - Intronic
1036503893 8:9337699-9337721 GAACCTTGACTGATTCTCTGTGG - Intergenic
1038396617 8:27250487-27250509 GAGGCTCTGCAGATGCTCTGCGG + Intronic
1042334348 8:67614504-67614526 GACCCGCTGCTGAATAACTGAGG + Intronic
1044216407 8:89616281-89616303 GTCCATCTGCTGCTTCTCTTTGG - Intergenic
1045816523 8:106283193-106283215 GAGCATCTGTAGATTCTCTGTGG + Intronic
1048602254 8:135930871-135930893 GCCCTTCTTTTGATTCTCTGAGG - Intergenic
1049539859 8:143203467-143203489 GAACCACTGCTGACTCTGTGGGG - Intergenic
1053788952 9:41672487-41672509 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1054156187 9:61642280-61642302 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1054177234 9:61883832-61883854 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1054475958 9:65573281-65573303 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1054660299 9:67696973-67696995 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1055153340 9:73030332-73030354 GTCACTCTGCTGATTGTCTCTGG - Intronic
1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG + Intergenic
1059828306 9:118059083-118059105 AACTCTCTCCTGAATCTCTGAGG + Intergenic
1062719190 9:138026327-138026349 CTCCCTCACCTGATTCTCTGTGG + Intronic
1188149444 X:26653709-26653731 GACACAGTGCTGGTTCTCTGCGG - Intergenic
1189225938 X:39413413-39413435 GTGCCTCTGCTGGTTGTCTGGGG + Intergenic
1189725655 X:43965933-43965955 GATCCTGTGCTGAGTATCTGTGG + Intronic
1189725660 X:43965967-43965989 GACTCTTTTCTGATTATCTGTGG - Intronic
1191128375 X:56982320-56982342 GCCCCACTGCTGATTAGCTGTGG + Intronic
1193300357 X:79881604-79881626 TACCCACTGCTGCTTCCCTGGGG + Intergenic
1195615066 X:106905669-106905691 TTCCTTCTGCTGATTCTCGGAGG - Intronic
1196005936 X:110837190-110837212 GACCCTCTGGGCAGTCTCTGGGG + Intergenic
1198720673 X:139615892-139615914 GACCATCAGCAGATGCTCTGTGG - Intronic
1199519383 X:148718312-148718334 GACCCTATGCTCATTTTGTGGGG - Intronic
1201157227 Y:11142279-11142301 GTCCCTTTGCTGTTTCTTTGGGG + Intergenic