ID: 1148161359

View in Genome Browser
Species Human (GRCh38)
Location 17:45451964-45451986
Sequence GCGGTTGGCCCCGCGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148161359_1148161365 8 Left 1148161359 17:45451964-45451986 CCCATCCTCGCGGGGCCAACCGC 0: 1
1: 1
2: 0
3: 1
4: 30
Right 1148161365 17:45451995-45452017 TCCTTTCAGATGCTTGAAACAGG 0: 1
1: 1
2: 0
3: 21
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148161359 Original CRISPR GCGGTTGGCCCCGCGAGGAT GGG (reversed) Intronic
903344749 1:22677110-22677132 GCGGCTGGCCCTAAGAGGATTGG - Intergenic
904286220 1:29454720-29454742 GCTGTGGGCACCGCGAGGCTGGG + Intergenic
904418020 1:30374660-30374682 GCTGTGGGCACCGCGAGGCTGGG - Intergenic
912717029 1:111990039-111990061 GCCGCTGGGCCCGCGGGGATCGG - Intergenic
1069673895 10:70233478-70233500 GGGGTTGGCCCGGCGGGGGTGGG - Intronic
1072898021 10:99383764-99383786 GCTGTTGGCCCTGCGAGGCCAGG + Intronic
1092217377 12:6692970-6692992 GCGGTGGCCCCAGGGAGGATAGG - Intergenic
1094466010 12:30754684-30754706 GCGGCTGACCCGGCGAGGGTGGG - Intronic
1103723451 12:122986626-122986648 GAGGTGGGGCCCGGGAGGATGGG - Exonic
1121311740 14:92939072-92939094 GGAGTTGGCCCCGCCAGCATCGG - Exonic
1129519324 15:76176145-76176167 GTGGTGGGCCCTGCAAGGATGGG + Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1132873335 16:2125060-2125082 TCGGCTGGCCCAGCGAGGAAGGG - Intronic
1134552423 16:15144239-15144261 TCGGCTGGCCCAGCGAGGAAGGG - Intergenic
1141643997 16:85357688-85357710 GCGGTTGTCCCAGCAGGGATGGG + Intronic
1148161359 17:45451964-45451986 GCGGTTGGCCCCGCGAGGATGGG - Intronic
1150392598 17:64798610-64798632 GCGGTTGGCCCCGGGAGGATGGG - Intergenic
1150506527 17:65704108-65704130 GAGGTTGGCCCTGCGACGACAGG + Intronic
1160811568 19:1015129-1015151 GCGGCTGGCCCCGCCAGGCCTGG - Intronic
1161453076 19:4357473-4357495 GGGGTTGGCCCTGGGAGGCTCGG - Intronic
1162968017 19:14164993-14165015 GCAGCTGGCCCCGAGGGGATCGG + Intronic
1164563241 19:29308483-29308505 GAGGCTGGCTCCACGAGGATGGG + Intergenic
926630445 2:15130779-15130801 GAGGGTGGCCCCCTGAGGATGGG - Intergenic
1185376739 22:50486130-50486152 TCGGCGGGCCCAGCGAGGATGGG - Exonic
975281554 4:72568377-72568399 CCAGATGGCCCGGCGAGGATGGG + Intronic
1004035349 6:11917816-11917838 TCGGCTGGCCCCTAGAGGATTGG - Intergenic
1037177829 8:15967606-15967628 GTGGGTGGCCCCGAGAGGCTGGG - Intergenic
1040391585 8:46954967-46954989 CCGGCTGGCTCCGGGAGGATGGG + Intergenic
1049632281 8:143665234-143665256 GCTGTTGGCCCCGCGTGGGCAGG + Intergenic
1049643902 8:143727676-143727698 GCGGCTGCCACGGCGAGGATGGG - Exonic
1052930103 9:34049039-34049061 GCGGTTGGCTTCGCGGGGTTGGG - Intergenic
1057310043 9:93936992-93937014 GTGGTTGGCCAAGGGAGGATAGG + Intergenic
1198533320 X:137565760-137565782 GCTCTTTGCCCCGCGAGGATCGG - Intergenic