ID: 1148161506

View in Genome Browser
Species Human (GRCh38)
Location 17:45453015-45453037
Sequence TGCCCCTGCTCTGAAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 2, 1: 0, 2: 0, 3: 22, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148161506 Original CRISPR TGCCCCTGCTCTGAAAGAAC AGG Intronic
900322580 1:2092422-2092444 TACCCCTGCTCTGAAATGCCCGG + Intronic
900489056 1:2937272-2937294 TGCCCCTGCCCTGAGAGGCCAGG + Intergenic
901436385 1:9249607-9249629 TGCCCCTGGGCTGAAGGTACAGG - Intronic
902788914 1:18751815-18751837 GGCCCCTGCTCTGAGGGAAGGGG + Intergenic
903498207 1:23786081-23786103 TGCTCCTGCCCTCAAGGAACAGG - Intronic
903888174 1:26553333-26553355 TGCCCCAGCTCTTAAGGAAGAGG + Intronic
904758370 1:32782437-32782459 TACCCCTGCCCTGAAAAAACTGG - Exonic
913451449 1:118995362-118995384 TGTCTCTGGTCTGAAAGTACAGG - Intergenic
914836483 1:151211110-151211132 TGCTTCTGCTCTGAAAGTGCAGG + Intronic
920830378 1:209459618-209459640 TCCCCTTGCTCTGAGGGAACAGG + Intergenic
920971357 1:210745993-210746015 TGCCCCAGCTCTCGAAGAATGGG - Intronic
924707313 1:246510956-246510978 TGCCCTTGCCCTGAAAGCTCTGG + Intergenic
1064432790 10:15285702-15285724 TGCCTCTGATCTGAAAGACTTGG + Intronic
1067768148 10:49104424-49104446 TGGCCCTGCCCAGGAAGAACAGG + Intronic
1070797804 10:79227137-79227159 TGCCCCTGCTTTCTATGAACAGG + Intronic
1072010430 10:91298522-91298544 TGCCCCAGCCCTGAAGGAAGTGG - Intergenic
1072524322 10:96258128-96258150 TGGCCTTGCTATGAAATAACAGG + Intronic
1072804991 10:98418588-98418610 AGCCTCTGCTCTGAAAGAATTGG + Intronic
1072952376 10:99859013-99859035 TGCCCCTGCTCTGAAGCACTGGG + Intergenic
1072960969 10:99928815-99928837 TAGCCCTGCTCTGAAAGGAGCGG + Intronic
1073065164 10:100754261-100754283 TACACCTCCTTTGAAAGAACAGG + Intronic
1073758213 10:106603595-106603617 TCCCCCTGCAGTGAAAGAACTGG - Intronic
1074159842 10:110828445-110828467 GGCCCCTGCTCTGCAAGTTCAGG - Intronic
1074568230 10:114600873-114600895 TGCCCTGGCTCTGAAATAACAGG + Intronic
1076142035 10:128086872-128086894 TGCCCCTCGTCTCAAAGGACGGG + Intergenic
1076188064 10:128464241-128464263 TGTCCCTGTTCTGAGAGAGCTGG - Intergenic
1077905790 11:6532474-6532496 TGCCCTTGCTCTAGAAGAAGGGG - Intronic
1086089546 11:82991972-82991994 GGTCCCTGCTGTTAAAGAACAGG - Intronic
1087958460 11:104319179-104319201 TTCTCCTGATCTGAAGGAACAGG + Intergenic
1089718122 11:120383638-120383660 TGCCACTGATCTGACAGAAGTGG + Intronic
1091526364 12:1305161-1305183 GGACGCTGCTCTGAAGGAACAGG - Intronic
1094427153 12:30327832-30327854 TGCCCCAGCTCAGAAGGGACGGG - Intergenic
1096784515 12:54009362-54009384 TGCCCACGCTCTGAGGGAACCGG - Exonic
1097251031 12:57632457-57632479 TGCCACTGCCCTGATAGAGCGGG - Intronic
1098758400 12:74392272-74392294 AGTCTCTGCTCTGAAAGACCAGG - Intergenic
1104467458 12:129002544-129002566 TGCATCTGACCTGAAAGAACAGG - Intergenic
1104906239 12:132214882-132214904 ATCCCCTGCTCTGCAAGATCAGG - Intronic
1106410224 13:29506188-29506210 TGCCTCTGCTCTGCAAGGCCGGG + Intergenic
1118897181 14:69954753-69954775 TGCCCCGGCTCTAAGACAACAGG - Intronic
1121518674 14:94570697-94570719 TGCCCCGGCCCTGAAAGCACAGG - Intronic
1121537054 14:94698132-94698154 AGCCCCTGTTCTGGAAGATCTGG + Intergenic
1122003595 14:98684410-98684432 TGCCCGTGATCTGATACAACTGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124512698 15:30340442-30340464 TGCTCCCGCTCTGATGGAACAGG + Intergenic
1124730217 15:32190308-32190330 TGCTCCCGCTCTGATGGAACAGG - Intergenic
1128433774 15:67625046-67625068 TGCTTCTGCTGTGAAAGAAGGGG + Intronic
1128449765 15:67798502-67798524 TGCGGCTGCTCTGTAAGTACAGG + Intronic
1131337289 15:91561460-91561482 TGCCCCTGCTTAGAATAAACTGG - Intergenic
1131674370 15:94655807-94655829 AGCCCCTGAACTGAAAGAAGCGG - Intergenic
1134086760 16:11362607-11362629 TGCACCTGCTCTTGAAGAAGGGG + Intronic
1134150680 16:11802349-11802371 TAGCCCTGCTCTGCAAGAAGCGG + Intergenic
1134399123 16:13892614-13892636 TGCCCCTGCTGTGATGGAAGGGG - Intergenic
1135069100 16:19336964-19336986 TGCCCTTGCTATGTAGGAACAGG + Intergenic
1138483301 16:57318400-57318422 TGCCTCTGCTCTGGAAGGACAGG + Intergenic
1141480726 16:84304907-84304929 AGCCCCTGGACTGAAAGAATGGG + Intronic
1144157444 17:12520221-12520243 TGGCCCTCCTCTGAAATGACTGG + Intergenic
1148161506 17:45453015-45453037 TGCCCCTGCTCTGAAAGAACAGG + Intronic
1148367192 17:47064356-47064378 TGCCAGTGCTCTGGAAGAGCGGG - Intergenic
1149477702 17:56977073-56977095 TGCCCCTGCACTGAAAGCTGCGG - Intergenic
1150191138 17:63240588-63240610 TGGCACTGCTCTGAAGGTACAGG - Intronic
1150392743 17:64799660-64799682 TGCCCCTGCTCTGAAAGAACAGG + Intergenic
1150874590 17:68955473-68955495 TGCCACTGCTCTGCAGGAACTGG - Intergenic
1151215193 17:72572224-72572246 TCCCTCTGCTATGAAAGAACAGG + Intergenic
1153977344 18:10281083-10281105 TAGCCCTGCCCTGAAAGAAGGGG - Intergenic
1155125974 18:22875960-22875982 TGACCCTGAACTGAAATAACTGG + Intronic
1155582499 18:27324976-27324998 TGCTCCAGCGCTGAAAGGACTGG - Intergenic
1156178342 18:34574040-34574062 TGTCGCTGCTCTAGAAGAACTGG - Intronic
1157153991 18:45246892-45246914 TTCCCCTCCTCTGAAAAAATGGG - Intronic
1163644374 19:18480111-18480133 TGACCCAGCTCTGTAAGATCAGG - Intronic
1164809683 19:31146451-31146473 TGCCCCTGCTGAGACAGACCTGG + Intergenic
1166979133 19:46622372-46622394 TGCCCCTCATCTGTAAAAACGGG + Intronic
1167085646 19:47307880-47307902 CGCCCCTGATCTGACAGATCAGG - Intronic
925026150 2:608836-608858 AGCCCCTGTTCTGAAAGAGCTGG - Intergenic
925557824 2:5151976-5151998 TGCCGCTGGTCTGAAAGGAGAGG + Intergenic
925998200 2:9308939-9308961 GGCCGCTTATCTGAAAGAACGGG - Intronic
926401487 2:12501618-12501640 TGCCCCTCCACTGACTGAACAGG + Intergenic
927026331 2:19072707-19072729 GGCCCCTGCTCTGAAAAAGGTGG - Intergenic
927456148 2:23250942-23250964 TGCACCTGCTCTTGAAAAACAGG - Intergenic
927881725 2:26693828-26693850 TGCCCTGGCTTGGAAAGAACTGG - Intronic
928489246 2:31764350-31764372 TTCTCCTGCCCTGAAAGTACAGG + Intergenic
928877301 2:36054987-36055009 TGCCTCTGCTCTTTAAGAACAGG + Intergenic
930048211 2:47192569-47192591 AGCTCCTGCTCTCAAAGACCTGG - Intergenic
930719942 2:54629155-54629177 TGCGCCTGCTCAGCAAGCACCGG + Exonic
931859214 2:66336151-66336173 TTCCCCTGCTCTGAAAGCAGGGG + Intergenic
932569702 2:72932066-72932088 TGCTCCTGCTCCCAGAGAACTGG - Intronic
934278899 2:91594225-91594247 TGCCCCTGGTCTGAAACTATCGG - Intergenic
935071005 2:99693613-99693635 TTTCCCTGCTCTTAAGGAACCGG - Intronic
935267182 2:101404768-101404790 TCTCTCTGCTCTGAAAGAGCAGG + Intronic
941169152 2:162116638-162116660 TGCCACTGTTTTGAAAGAAGAGG + Intergenic
944582525 2:201144688-201144710 TGCCCCTGTGTTGAAGGAACAGG + Intronic
948856631 2:240733267-240733289 TCCCCATGCTCGGAAAGATCTGG - Intronic
1168901753 20:1370824-1370846 TGACTCAGCTCTCAAAGAACAGG + Intronic
1169066635 20:2697698-2697720 TGCCCCTGCCCTGAGCCAACAGG + Intronic
1170307171 20:14951263-14951285 TACCCCAGTTCTGTAAGAACTGG - Intronic
1171497326 20:25565027-25565049 TGCCCCTACCCTGAAAGATTGGG - Intronic
1172859572 20:38037003-38037025 TGCCCCCACACTGAAAGAAAAGG + Intronic
1175838763 20:62013687-62013709 TGCTGCTGCTCTGAATGACCTGG - Intronic
1179354940 21:40650526-40650548 TATCCGGGCTCTGAAAGAACTGG - Intronic
1181824248 22:25501451-25501473 TGACACTGCTCTGAAAGGATAGG + Intergenic
1185103408 22:48853781-48853803 TGGATCTGCTCTGAAAGAAAGGG + Intergenic
949487085 3:4550200-4550222 TGGCCCTGCTCAGAGAGATCTGG - Intronic
949875123 3:8621489-8621511 GGCCTCTCCTCTGACAGAACAGG - Intronic
950074814 3:10180031-10180053 TTACCCTCCTCTGAGAGAACAGG + Intronic
950756377 3:15176372-15176394 TGGCTCTGCTCTAAAAGATCTGG + Intergenic
954445315 3:50543170-50543192 TGCCCCTGCTCTGGAACTAGGGG - Intergenic
959470956 3:106749833-106749855 TACTCCTGCTCTGGAACAACAGG - Intergenic
959844167 3:111013705-111013727 ACCCCCTGGTCTGAATGAACAGG + Intergenic
960295588 3:115939806-115939828 TGCTCCTCCTCTCAAAGCACTGG + Intronic
960703146 3:120456703-120456725 TGCCTCAGCTCTGAAAGTGCTGG - Intergenic
961325972 3:126109569-126109591 TGCACCTGCATTGAGAGAACAGG + Intronic
962383304 3:134913728-134913750 TGACTCTGCTCTGGATGAACAGG - Intronic
966927114 3:184651956-184651978 TTCCCCTGCCTTGAAACAACAGG + Intronic
967260181 3:187634296-187634318 TGCAGCTGCTCTCAAATAACAGG + Intergenic
967624863 3:191671256-191671278 TGCCCCTGCTCTAGAAGAGCGGG + Intergenic
969031892 4:4222264-4222286 TGCCCCTGGTCTGAAACTATCGG + Intronic
972536485 4:40004213-40004235 TGTCCCTGCTTTGCAACAACTGG + Intergenic
973609099 4:52617274-52617296 TGGCCCTTCTCTGAAATAAGAGG + Intronic
973868559 4:55140188-55140210 TGCCCCTGGTATGAAAGTCCTGG - Intergenic
975656530 4:76646667-76646689 TTCCCCTGCTTTTAAAGAATTGG - Intronic
981774447 4:148349104-148349126 TGCCACTGCTATGAAACAAATGG - Intronic
983285983 4:165740053-165740075 TGTCCCTGTTCAGAAAGAACAGG + Intergenic
985140810 4:186839416-186839438 TGCTCCTATTCTGAAAGAAATGG - Intergenic
986740472 5:10700961-10700983 GGCCCCTGCTCTGAATAGACGGG + Intronic
986979017 5:13424880-13424902 AGTCCCTGCTTTCAAAGAACCGG - Intergenic
987703036 5:21426471-21426493 GGGCCCTAATCTGAAAGAACTGG - Intergenic
990707678 5:58548300-58548322 TGTCCCTGCTCTGAGATAATTGG - Intronic
990770714 5:59241303-59241325 TGCCACTCCTCAGAAAGAACAGG - Intronic
991008303 5:61854108-61854130 GACCCCTGGTCTGCAAGAACAGG - Intergenic
991590629 5:68247843-68247865 TGCCCATGATCTGGAAAAACAGG - Intronic
991748998 5:69778948-69778970 TGCACATGTTCTGAAAGAAGTGG - Intergenic
991800579 5:70358759-70358781 TGCACATGTTCTGAAAGAAGTGG - Intergenic
991828021 5:70651282-70651304 TGCACATGTTCTGAAAGAAGTGG + Intergenic
991892936 5:71358199-71358221 TGCACATGTTCTGAAAGAAGTGG - Intergenic
992479237 5:77134213-77134235 AGGCAATGCTCTGAAAGAACAGG + Intergenic
993054349 5:82964926-82964948 TGTACTTACTCTGAAAGAACTGG - Intergenic
994093927 5:95831996-95832018 TGCCCCTGCTCAGCAGGCACAGG - Intergenic
995395364 5:111681445-111681467 TGCCCCTGCCTAGAAAGAAAAGG - Intronic
995462344 5:112418028-112418050 CGCCCCCGCTCTGATAGAGCTGG - Intronic
1000662028 5:163949258-163949280 TGTCCCTGCTGGGCAAGAACTGG - Intergenic
1000836103 5:166156092-166156114 TGCCCCTGCTCTGGCAGACCTGG - Intergenic
1001648208 5:173297586-173297608 TGCCCCTGCACGGAATGACCAGG - Intergenic
1003423454 6:5978837-5978859 TTCCCCCACTCTGAAAAAACAGG - Intergenic
1005710554 6:28500145-28500167 TGCCACTGCTCTGAAAATCCAGG - Intergenic
1009557693 6:65195138-65195160 TGCTCCTGCTCTAAAATAATTGG + Intronic
1012049560 6:94324034-94324056 TGCCACTGATCTGACAGAAGGGG + Intergenic
1012402947 6:98859451-98859473 TGCCCCTTCTATGATAGAAGTGG + Intergenic
1013650954 6:112193913-112193935 AGCCCATTCTCTGAAAGAACAGG + Intronic
1015269445 6:131324332-131324354 TGCCCCTCCTCTGGAAAAGCGGG - Intergenic
1015594118 6:134850068-134850090 TGCCCCAGCTCTGAACAAATAGG + Intergenic
1015866196 6:137729336-137729358 TGCTGCTGCTCTGAGAGAGCAGG - Intergenic
1017397737 6:154022393-154022415 GGCCCCTGCTCTGGAAGGAAGGG - Intronic
1017652920 6:156599489-156599511 CGCCCCTTCTCTGAAGGATCAGG + Intergenic
1018319394 6:162591014-162591036 GGGCCCTCCTCTGAAGGAACAGG + Intronic
1019671710 7:2283461-2283483 TGTCCTGGCTCTGAAAGCACCGG - Intronic
1022968207 7:35493835-35493857 AGCCCCAGCTCTGAAGGAACAGG + Intergenic
1023908701 7:44539361-44539383 TGCCCCAGCCCTGGAAGAACTGG + Exonic
1028512326 7:91638873-91638895 TGCCTCTGCTCGGAAAGCAGGGG + Intergenic
1034498626 7:151436226-151436248 AGCCCCTGCTCTGGAGGAAGGGG + Exonic
1034594548 7:152177355-152177377 TGACCCTTCTGTGAAGGAACTGG - Exonic
1037911341 8:22745380-22745402 TGCCCCTGCCCTGAATCACCAGG - Intronic
1038431867 8:27506952-27506974 TGACACGGCCCTGAAAGAACTGG + Exonic
1039819816 8:41125588-41125610 TGAGGCTGCTCTGAAAGCACTGG - Intergenic
1041567944 8:59301949-59301971 TGTCCCTGCTGTTAAAGAATAGG + Intergenic
1042091675 8:65165860-65165882 TGCCCCAGCTCTGGACGGACGGG - Intergenic
1042247923 8:66726417-66726439 AGCCCCTCATCCGAAAGAACAGG + Intronic
1046942403 8:119943730-119943752 AGCTCCTGGTCTGACAGAACGGG - Intronic
1047055542 8:121160523-121160545 TGCCACTCCACTGCAAGAACTGG + Intergenic
1047131992 8:122031566-122031588 TGGCTCTGCTCTGAAACTACAGG + Intergenic
1047644016 8:126850915-126850937 TGCCCCTGCCCTTTAAGAAGGGG - Intergenic
1047752400 8:127891708-127891730 TGGCTCTGCTCAGAAAGATCAGG - Intergenic
1049747570 8:144269459-144269481 TGCCCCTCCTCTGCAAAGACAGG + Intronic
1050991887 9:12166510-12166532 TAGCCCTGCTCTGAAGGAACAGG - Intergenic
1052744251 9:32424295-32424317 TGCCACCTCTCAGAAAGAACAGG - Intronic
1054693035 9:68333417-68333439 TGCCTCTGCTATGGAAGAAGGGG + Intronic
1056758808 9:89400200-89400222 TGTCCCTGGTTTGAAAGAAGAGG - Intronic
1058930264 9:109711855-109711877 GTCTCCTGCTCTGAAAGAAATGG - Intronic
1059442286 9:114315201-114315223 TGCCCCTGCTGGGAATGAGCTGG - Intergenic
1059840166 9:118206099-118206121 GGCACCTGCTCTGAAAAAATTGG + Intergenic
1061955153 9:133957491-133957513 TGCCCCTTCGCTGACAGCACAGG + Intronic
1186623440 X:11265950-11265972 TGCCTCTGTTCTGAAAGGACAGG - Intronic
1187031700 X:15494507-15494529 GATCCCTGCTCTAAAAGAACAGG + Intronic
1187396870 X:18926994-18927016 TGCCCCTGCTCCCAAAGGACGGG + Intronic
1187953611 X:24494203-24494225 AGCCCCTCCTCTGGAAGCACAGG + Intronic
1190438225 X:50448980-50449002 TGCCCCTGCTCTGGGATAAAAGG - Intronic
1192058054 X:67793248-67793270 TGCCCTTGCTGAAAAAGAACTGG - Intergenic
1197088097 X:122503052-122503074 GGCCCCTGCTCTGAAACCACTGG - Intergenic
1202028465 Y:20549539-20549561 TTCCTCTGCTCTTAAAGCACAGG + Intergenic