ID: 1148165028

View in Genome Browser
Species Human (GRCh38)
Location 17:45477556-45477578
Sequence TAGTTACAACAGAGGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 2, 1: 2, 2: 8, 3: 55, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148165028_1148165030 -2 Left 1148165028 17:45477556-45477578 CCACACAACCTCTGTTGTAACTA 0: 2
1: 2
2: 8
3: 55
4: 261
Right 1148165030 17:45477577-45477599 TATGTAACTCTGCCCCAGTGTGG 0: 1
1: 1
2: 1
3: 5
4: 101
1148165028_1148165036 26 Left 1148165028 17:45477556-45477578 CCACACAACCTCTGTTGTAACTA 0: 2
1: 2
2: 8
3: 55
4: 261
Right 1148165036 17:45477605-45477627 AAGGCTGTTCCTGCTAAAGGTGG 0: 2
1: 0
2: 1
3: 8
4: 162
1148165028_1148165035 23 Left 1148165028 17:45477556-45477578 CCACACAACCTCTGTTGTAACTA 0: 2
1: 2
2: 8
3: 55
4: 261
Right 1148165035 17:45477602-45477624 AAAAAGGCTGTTCCTGCTAAAGG 0: 2
1: 0
2: 0
3: 23
4: 457
1148165028_1148165031 7 Left 1148165028 17:45477556-45477578 CCACACAACCTCTGTTGTAACTA 0: 2
1: 2
2: 8
3: 55
4: 261
Right 1148165031 17:45477586-45477608 CTGCCCCAGTGTGGCAAAAAAGG 0: 2
1: 0
2: 2
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148165028 Original CRISPR TAGTTACAACAGAGGTTGTG TGG (reversed) Intronic
900708185 1:4093833-4093855 AAGGTACAAGAGAGGTTGGGTGG - Intergenic
901694468 1:10996450-10996472 TAGTTACAGCAGAGATTGTATGG - Intergenic
902056977 1:13609128-13609150 TAGTTAGAATAGAGACTGTGTGG + Intronic
902509209 1:16956530-16956552 TAGTTGCAACAGAGACTGTGTGG - Intronic
902822043 1:18949347-18949369 TAGTTACAACTCCGGGTGTGGGG + Intronic
904741459 1:32679505-32679527 TAGTTGTAACACAGATTGTGTGG + Intronic
905281897 1:36854652-36854674 TAGTTGCAGCAGAGACTGTGTGG + Intronic
906996041 1:50795387-50795409 TAGTTAGAACCAAGGTTGTGTGG - Intronic
907030395 1:51165340-51165362 TTGTTATAAAAGAGGTTCTGAGG - Intergenic
907593474 1:55698349-55698371 TAGTTGCAACAGAGACTCTGTGG - Intergenic
908228651 1:62082107-62082129 AAACTACAACAGAGGCTGTGTGG - Intronic
909003311 1:70244877-70244899 TAGTAACAAAAGAGGTGGTTGGG + Intronic
909259403 1:73468051-73468073 TAGTTTCAACAGAACTTGTCAGG + Intergenic
909418155 1:75430890-75430912 AAGTTACAAGAGAGGTGGTGGGG - Intronic
913438908 1:118876594-118876616 AAGTTGAAACAGAGGTTGAGGGG - Intergenic
915527375 1:156484327-156484349 TAGTTACAACAGAGACTGTATGG - Intronic
916481412 1:165217992-165218014 TAGCTGCAACAGAGACTGTGAGG - Intronic
916942523 1:169690778-169690800 TAGTTATAAAAGAAGTGGTGGGG + Exonic
917641488 1:176987245-176987267 TAGTTGCAACAGAGACTGTTTGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918104981 1:181409170-181409192 TAGTTGCAACAGAGATTGTGTGG + Intergenic
920518013 1:206600873-206600895 CAGTTGCAACAGAGATGGTGTGG + Intronic
920536889 1:206743199-206743221 GAGATTCAAAAGAGGTTGTGTGG + Intergenic
923733283 1:236575454-236575476 TAGCTGCAACAGAGACTGTGTGG + Intronic
923893935 1:238248162-238248184 TAGTTGCAACAGAGACTCTGTGG + Intergenic
1065344133 10:24732867-24732889 TAGTTGCAACAGAGGTCGCGTGG - Intergenic
1065468514 10:26051860-26051882 TATTTGTAACACAGGTTGTGTGG + Intronic
1065616695 10:27534555-27534577 TAGTTACAACAGAGGCCATACGG + Intronic
1066054577 10:31668528-31668550 CTGTTACAAAAGAGGTTGTAGGG - Intergenic
1066316758 10:34255087-34255109 TGGTTGCAACAGAATTTGTGGGG - Intronic
1071837741 10:89436139-89436161 TAGTGACCACAGAGATAGTGGGG - Exonic
1071922311 10:90364636-90364658 TAGTTGCAACAGAGATTATATGG - Intergenic
1072304193 10:94091427-94091449 TGGTTACAACACAGCTTCTGAGG + Intronic
1072449048 10:95524662-95524684 TAGTTACAACAGAGAATGTATGG + Intronic
1073040478 10:100601022-100601044 TCCTTACAAAAGAGGTTGAGGGG - Intergenic
1073202073 10:101743659-101743681 TAGTTGCAACAGAGACTGTATGG - Intergenic
1074379579 10:112968178-112968200 TAGTTGCAACAGAGACTGAGCGG - Intronic
1074388406 10:113035878-113035900 TAGTTATGACAGAGATTGTGTGG + Intronic
1077649270 11:3955192-3955214 AAGTTGGAACAGTGGTTGTGTGG + Intronic
1078732205 11:13985099-13985121 TTGTTAAAACACAGGTTGTGAGG - Intronic
1079121704 11:17689881-17689903 AAGTTACAACAGAGGTCCTAAGG - Intergenic
1080333628 11:31171276-31171298 TAGTTGCAACAGAAATTGTATGG - Intronic
1080336655 11:31205279-31205301 TAGTTGAAACAGAGGCTGTATGG + Intronic
1082897291 11:58205355-58205377 TAGTAACAACAACGGTTTTGCGG + Intergenic
1084843044 11:71873625-71873647 TAGTAAAAACAGAGGCTATGAGG + Intronic
1086473539 11:87144356-87144378 TAGTTGCAACAGAGACTGTATGG - Intronic
1087379744 11:97389804-97389826 TAGTTAGTACAGAGTTTGTTTGG - Intergenic
1087611645 11:100441692-100441714 TAGTTAGATCAGGGGTTGTCGGG + Intergenic
1088480301 11:110290735-110290757 TGGTTTCAACAGAGACTGTGTGG - Intronic
1090055399 11:123419227-123419249 AAGTGACCACAGAGGTTGTCTGG + Intergenic
1091845084 12:3649592-3649614 TAATTATAACAGGAGTTGTGAGG + Intronic
1092217220 12:6691966-6691988 TAGTTGAAACAGAGACTGTGGGG - Intergenic
1092307079 12:7312073-7312095 TAGTTACAACAGAAACTGTATGG + Intronic
1092575389 12:9776952-9776974 TAGTGACAACACAGGTTATGAGG - Intergenic
1092768587 12:11875894-11875916 TAGTTACAACAGAGATTGCATGG + Intronic
1095398573 12:41789304-41789326 GGGTTACAACAGAGATTGTGAGG - Intergenic
1096925623 12:55141711-55141733 TAGATGCCAGAGAGGTTGTGGGG + Intergenic
1097479231 12:60100265-60100287 TAGTTACAACAGAAATGGTCTGG + Intergenic
1099689283 12:85930613-85930635 TAGATACAGTAGTGGTTGTGTGG + Intergenic
1099896253 12:88651108-88651130 TAGTTGTAACAGAGGCTATGGGG + Intergenic
1100080685 12:90846442-90846464 GAGAAACAACAGAAGTTGTGGGG - Intergenic
1100687730 12:97004748-97004770 TATTTACAAGAGAGGATGTATGG + Intergenic
1100924572 12:99530039-99530061 TAGTTACAACAGAGACCATGTGG - Intronic
1101233803 12:102767892-102767914 TAGTTAAAACACAGCTTGTTGGG + Intergenic
1101993888 12:109510988-109511010 TAGCTACAACAGAGACTGTCTGG - Intronic
1102369529 12:112370965-112370987 GTTTTACAACAGTGGTTGTGGGG - Intronic
1102814832 12:115857229-115857251 TACTTCCTAAAGAGGTTGTGAGG - Intergenic
1102891162 12:116559567-116559589 TAGTGAAAGCAGAGGCTGTGGGG - Intergenic
1103057047 12:117829692-117829714 TAGTTGCAACAGAGACCGTGTGG - Intronic
1103499221 12:121388025-121388047 TGGTTACAGTGGAGGTTGTGAGG + Intronic
1103625740 12:122218088-122218110 TAGTTTCAACAGAGGCTGTAAGG - Intronic
1103890280 12:124233308-124233330 TAGTTGCATCAGAGATTGTCTGG + Intronic
1104161697 12:126187266-126187288 CAGCTAAAACAAAGGTTGTGAGG - Intergenic
1105989759 13:25607184-25607206 TAATTTTAACACAGGTTGTGGGG - Intronic
1106354758 13:28970491-28970513 TAGTTACAACAGGGACTGTGTGG + Intronic
1107439311 13:40410456-40410478 TTGTGATAACAGATGTTGTGGGG + Intergenic
1107503439 13:41005425-41005447 TAGGTATAGCAGAGGTTGGGGGG - Intronic
1110191990 13:72740650-72740672 TGGTTCCAACAGAGGTTGTGTGG - Intronic
1110246962 13:73336986-73337008 TAATTGCAGCAGAGGTTATGTGG + Intergenic
1111509798 13:89246192-89246214 TAGTAACTACAGGGGTTGAGGGG + Intergenic
1113363131 13:109650004-109650026 TAGTTGCAACAGAGATTATATGG + Intergenic
1115311914 14:31987416-31987438 TGGTAATACCAGAGGTTGTGTGG - Intergenic
1117904252 14:60567828-60567850 TAGTTGAAACAGAGATTGTATGG - Intergenic
1118931924 14:70250774-70250796 TAATTATAACACAGATTGTGGGG + Intergenic
1118983057 14:70731531-70731553 TAGTTACAACAGAAACTGTACGG + Intronic
1119012096 14:71004165-71004187 TTGTTGCAACAGAGGTTATCTGG + Intronic
1120271107 14:82314185-82314207 TAGTTGCAACAGAGACTGTTTGG + Intergenic
1120298926 14:82680801-82680823 TAGTTGCAACAGAGACTGTGTGG - Intergenic
1120900539 14:89571614-89571636 TAGTTGCAACAGAGGTGGTGTGG - Intronic
1121738008 14:96232093-96232115 TAGCTACACCAGGGGCTGTGGGG - Intronic
1121836204 14:97094644-97094666 CAGTTGCAACAGAGATTGTATGG + Intergenic
1122157299 14:99757394-99757416 CAGTGACAGCACAGGTTGTGTGG + Intronic
1123906258 15:24924529-24924551 TACTTTCAACTGAGGTTATGTGG - Intronic
1125120338 15:36150358-36150380 TAATTTCAACAGAGTTTTTGTGG - Intergenic
1126293708 15:47112504-47112526 TAGTTGCAACAGAGACTGTATGG - Intergenic
1128117946 15:65123944-65123966 TAGTTGCAACAGAGACTGTATGG - Intronic
1128341383 15:66824812-66824834 TATTTAGCACAGAGTTTGTGGGG - Intergenic
1129181271 15:73878215-73878237 TAGTTGCAACAGAGACTGCGTGG - Intronic
1129496863 15:75991199-75991221 TAGTTGCAACAGAGACTGTATGG - Intronic
1130067932 15:80620535-80620557 TAGTTGCATCAGAGACTGTGTGG - Intergenic
1130802858 15:87284333-87284355 TAGTTCCAACAGTTTTTGTGTGG - Intergenic
1131348903 15:91678596-91678618 TTGTTAGAACACAGGTTGTTGGG - Intergenic
1132456423 16:26192-26214 TATTTATAACAGGGGCTGTGTGG - Intergenic
1134339726 16:13333933-13333955 TAGTTACAACAGAGACAGTCTGG - Intergenic
1134518531 16:14906451-14906473 TAGTTGCACCAGAGATCGTGTGG + Intronic
1134555399 16:15159766-15159788 TAGTTGCACCAGAGATCGTGTGG - Intergenic
1134706202 16:16305104-16305126 TAGTTGCACCAGAGATCGTGTGG + Intergenic
1134961338 16:18407006-18407028 TAGTTGCACCAGAGATCGTGTGG - Intergenic
1134965638 16:18489609-18489631 TAGTTGCACCAGAGATCGTGTGG - Intronic
1135194367 16:20382452-20382474 TAGTTACAACAGAGACTGCCTGG + Intronic
1135502564 16:23009684-23009706 TAGTTGCAACAGAGACTGTGTGG - Intergenic
1135852623 16:25978360-25978382 TAGTTACAACAGAGACTGTAGGG - Intronic
1140060087 16:71561536-71561558 TAGTTCTAACAGAGTTTTTGTGG + Intronic
1140151556 16:72372373-72372395 TAGTTACAATTGAGGCTCTGGGG - Intergenic
1143007714 17:3847578-3847600 TACCTACAAAGGAGGTTGTGAGG + Intergenic
1143975223 17:10824555-10824577 TATTTACATCAGAGGCAGTGGGG - Exonic
1144359882 17:14481946-14481968 TAGTTACATCAGAGACTGTGTGG + Intergenic
1145052291 17:19672185-19672207 TAGTTGCAACAGAGGCTGAATGG + Intronic
1147920193 17:43911600-43911622 TGCTTACAAGAGAGGTTTTGGGG - Intergenic
1148165028 17:45477556-45477578 TAGTTACAACAGAGGTTGTGTGG - Intronic
1149380403 17:56087839-56087861 TAGTCACAACAGAGCCTGTATGG + Intergenic
1149899242 17:60458570-60458592 TAGTTGCAGCAGAGAATGTGTGG - Intronic
1150396258 17:64824281-64824303 TAGTTACAACAGAGGTTGTGTGG - Intergenic
1152240134 17:79156698-79156720 GAGTTGCAGCAGAGGCTGTGTGG + Intronic
1153429270 18:4998069-4998091 TAGTTACAACAGAGATTGTGTGG - Intergenic
1153602541 18:6795537-6795559 TAGTTACAACAGAGATCATATGG - Intronic
1155441316 18:25865450-25865472 TAGTTGCAACAGAGATGGTGCGG + Intergenic
1159248007 18:65835155-65835177 TGGTAAGAACAGAGGTTGTATGG + Intronic
1161554646 19:4933856-4933878 TAGTTGCAACAGAGACTATGCGG + Intronic
1162991643 19:14306729-14306751 TAGTTGCAACAGAGAATGTCTGG + Intergenic
1163412678 19:17165957-17165979 TAGTTGCAACAGACATTGTCTGG + Intronic
1166126960 19:40720710-40720732 TAGTTACAGCAGAGGGGGTCAGG - Intronic
1166540361 19:43601250-43601272 TAGTTGCAACAGAGATTTTAAGG + Intronic
1167580825 19:50341337-50341359 TAGTTACCACAGAGACTGTCTGG - Intronic
1167876612 19:52419319-52419341 AAATTACCACAAAGGTTGTGGGG - Intergenic
925475921 2:4214897-4214919 TTGTTACAACACAGGTTGCTGGG + Intergenic
926444636 2:12927295-12927317 TAGTTACACCAGAGATCGTGTGG + Intergenic
926604305 2:14881779-14881801 TAGTTACAACAGAGCCTGTATGG + Intergenic
928351116 2:30556143-30556165 TAGGTACAACAGAGATAGTATGG - Intronic
928468933 2:31554155-31554177 TACTCACAACAGATGTTATGTGG - Intronic
930155173 2:48099289-48099311 GAGTATCAACAGAGGTTGAGTGG + Intergenic
930362889 2:50404107-50404129 AAGACACAACAGAGGGTGTGAGG - Intronic
930417377 2:51105575-51105597 TAGAAACAACAGAGGTTGAGTGG - Intergenic
931765629 2:65453640-65453662 TAGTTGCAACAGAGATTGTGTGG + Intergenic
931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG + Intergenic
932547889 2:72734517-72734539 TAGTTACAACAGAGATTGTATGG - Intronic
935609431 2:105005655-105005677 TAGTTGCAACAGAGGCCGTATGG - Intergenic
936859566 2:117001227-117001249 TATTTCCAACAGAGGTACTGGGG + Intergenic
937048791 2:118871231-118871253 AAATTAAATCAGAGGTTGTGAGG - Intergenic
938628973 2:133144231-133144253 TCATTACAACAGAGACTGTGTGG - Intronic
939082517 2:137679765-137679787 TAGTTGCAATAGAGATTGTTTGG - Intergenic
939653312 2:144790705-144790727 CAGTTACTAGAGAGGATGTGGGG + Intergenic
940062059 2:149583060-149583082 TAGTTACAAGAGATATTCTGTGG + Intronic
940280349 2:151982242-151982264 TAGTTGCAAGGGAGGCTGTGAGG - Intronic
941166570 2:162089444-162089466 TGATTGCAGCAGAGGTTGTGGGG - Intergenic
941501804 2:166288368-166288390 CGGTTACAACAGAGGCTCTGCGG - Intronic
942256362 2:174103439-174103461 TAGCTACAACAGAGACTGTGTGG + Intronic
942568831 2:177293123-177293145 TAGTTACAACAGATCTTGAAAGG + Intronic
942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG + Intergenic
943855395 2:192783760-192783782 TAGTTGCAACAGAGATTTTATGG + Intergenic
945253778 2:207787182-207787204 TGGTTGCAACAGAGATGGTGTGG - Intergenic
947181451 2:227415034-227415056 TAGTTACAACAGAAGCTGTATGG + Intergenic
948952994 2:241267032-241267054 AGCTTACATCAGAGGTTGTGAGG - Intronic
1170552275 20:17488424-17488446 TAGTTACAGCAGAGGCTGTGTGG + Intergenic
1171077642 20:22145119-22145141 TTGTAACCACAGAGATTGTGAGG + Intergenic
1172972619 20:38884443-38884465 TAGGTACAACAGAGACTGTATGG - Intronic
1173217459 20:41098944-41098966 TAGTTGCAAAAGAGACTGTGTGG + Intronic
1173525040 20:43725512-43725534 TAGTTGCAACACAGACTGTGTGG + Intergenic
1173899414 20:46576218-46576240 TAGTGACAACAGAGACTGTGTGG - Intronic
1174669911 20:52297549-52297571 TAGTTGCAACAGAGAATGTGTGG + Intergenic
1174729976 20:52906559-52906581 TAGTTGCAACAGAGACTGTATGG - Intergenic
1176119766 20:63449008-63449030 TAGTTCCAGCAGAGATTCTGGGG - Intronic
1177107654 21:16979835-16979857 TAGTTGCAACAGAGACTGTTTGG + Intergenic
1177566367 21:22827758-22827780 TATTTACAAAAGAGGCAGTGAGG + Intergenic
1178074915 21:29006036-29006058 TAGTTGCAACAGAGGCTGAAAGG + Exonic
1178366949 21:31996210-31996232 TTGTCAGAACAGAGGTTGGGAGG + Intronic
1179018944 21:37620296-37620318 TAATTACAACAGAGACCGTGTGG - Exonic
1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG + Intronic
1182130475 22:27846641-27846663 TAGTTGCAACAGAGACTGTATGG + Intergenic
1182577870 22:31285370-31285392 TAGATACCACATAGGTTGTGAGG - Intronic
1183013347 22:34965792-34965814 TAGTTACAACAGAGAATGTATGG + Intergenic
949830291 3:8207412-8207434 TAGTTGCCACAGAGATTGTTTGG - Intergenic
949864544 3:8536711-8536733 TAGTTACAACAGAGAGTATCTGG - Intronic
951547441 3:23842060-23842082 TAGTTACAATAAAGGTTTTAAGG - Intronic
951730547 3:25806217-25806239 TAGTTGCAACAGATACTGTGTGG + Intergenic
951993771 3:28704399-28704421 TAGTTGCAGCAGGGGTTGAGGGG + Intergenic
954963979 3:54594225-54594247 TAGTTACAGCAGAAATTGTATGG - Intronic
955591715 3:60543136-60543158 TAATTGCAACAGACATTGTGTGG - Intronic
956397041 3:68837116-68837138 TAATTGCAACAGAGGCTGTATGG + Intronic
956617455 3:71186927-71186949 TTGTTGCAACAGAGATTGTGTGG - Intronic
956780885 3:72602261-72602283 TAGTTGCAACAGAGACTGTGTGG + Intergenic
957313754 3:78551499-78551521 TAGTTACAACAGAGACCTTGTGG + Intergenic
957840576 3:85663527-85663549 TAGTGAGCACAGAGGTTGTTGGG - Intronic
958002450 3:87767703-87767725 AAAATACAACAGAGGTTGTGAGG - Intergenic
958135361 3:89482684-89482706 TAGTTCCAACAGAGATCATGAGG + Intergenic
959232103 3:103667518-103667540 TAGTTACATCAGAGACTGTGTGG - Intergenic
959361414 3:105398061-105398083 TTGTTAAAACATAGGTTGTTGGG + Intronic
960197029 3:114781272-114781294 TATTTACAAGAGTTGTTGTGAGG + Intronic
961633759 3:128320124-128320146 TAGTTGCAACAGAGGTTGTGTGG + Intronic
961938327 3:130609993-130610015 TAGTTGCCACTGGGGTTGTGGGG + Intronic
962145805 3:132838747-132838769 TAGTTGCAACAAAGATTATGTGG + Intergenic
962622506 3:137193721-137193743 TATGTCCAACAGAGGTTGAGTGG - Intergenic
963234399 3:142942639-142942661 TAGTTGCAACAGAGATTGTATGG - Intergenic
964166965 3:153719316-153719338 TAGTTGCAACAGAGTCTGTATGG - Intergenic
964391598 3:156203232-156203254 TAGTTGCAATAGAGATTGTATGG + Intronic
964593622 3:158396184-158396206 TACTTACGGCAGAGGTTGGGAGG + Intronic
964637330 3:158871800-158871822 TAGGTACAACAGAGCTTGCAGGG + Intergenic
966988013 3:185199945-185199967 TAGTTGCAACAGAGACTGTATGG + Intronic
969784131 4:9439683-9439705 TAGTAAAAACAGAGGCTATGAGG + Intergenic
970403552 4:15740903-15740925 TAGTTGCGACAGAGGTTGCATGG - Intergenic
972855424 4:43099880-43099902 TAGTTACCACAGAGACTGTATGG - Intergenic
973208562 4:47588515-47588537 TAGTTCCAACAAAGTTTGTCTGG + Intronic
973533664 4:51858869-51858891 TAGTTGCAACAGAGACTGTATGG + Intronic
974011481 4:56611659-56611681 TAGTTGCTGCAGAGGTTGTGAGG - Intergenic
976339818 4:83934620-83934642 GAGTTACAGCAGAAGTTGTCAGG + Intergenic
977498058 4:97801993-97802015 TTGTTACAACAGAGGTTGGTTGG + Intronic
979975712 4:127193884-127193906 TGAGTACAACAGAGATTGTGTGG - Intergenic
980492193 4:133542690-133542712 TAGCTAGAACTTAGGTTGTGTGG + Intergenic
980652285 4:135733685-135733707 TATTTGCAACAGAGATTGTGTGG - Intergenic
980754535 4:137140378-137140400 TAGTTACAACAAAGATTGTCTGG - Intergenic
980778969 4:137472144-137472166 TAGTTCCAACAGAGATTATATGG + Intergenic
982685275 4:158481205-158481227 GAGTTACAGCAGAGGTTTGGAGG - Intronic
982940098 4:161539598-161539620 TAGTTGCCACAGAAATTGTGTGG - Intronic
984868524 4:184306706-184306728 TAGTTAAGACAGAGACTGTGTGG + Intergenic
986749358 5:10772704-10772726 TAGTTGCAACAGAGGTGGCATGG + Intergenic
987828587 5:23065022-23065044 CAGTGAAAAAAGAGGTTGTGAGG - Intergenic
987979629 5:25065241-25065263 GATTTACAACAGAGTTTGTTTGG + Intergenic
989034535 5:37156196-37156218 TAGGTTCCACAGTGGTTGTGAGG - Intronic
989497713 5:42128506-42128528 TTTTTAGAACAGAGGCTGTGAGG - Intergenic
990151039 5:52817907-52817929 TAGTCACTACAGAGCTTGTGTGG - Intronic
990388228 5:55290026-55290048 TAGTTGTAACAGAGGCTGTATGG + Intronic
990782452 5:59380974-59380996 TAGTTACTACAGAGTTCTTGTGG + Intronic
992589104 5:78275009-78275031 TAGTTACATCAGAGATGGTATGG - Intronic
993557652 5:89361572-89361594 TAGTTGCAACAGAGATTTTCTGG + Intergenic
995166371 5:109047567-109047589 CATTTAGAAGAGAGGTTGTGTGG - Intronic
995385188 5:111581009-111581031 TAGTTGCAACAGAGATTGTATGG + Intergenic
995651848 5:114378263-114378285 TAGTTGCAACAGAGGCCATGTGG + Intronic
995708701 5:115012687-115012709 TAGTTATGACAGAGACTGTGTGG + Intergenic
996813716 5:127549804-127549826 TAGTTGCAACAGAGAATGTCTGG + Intronic
997491155 5:134277394-134277416 TAGTTAAAACAGTGGTTGGATGG - Intergenic
999918763 5:156294211-156294233 TAGTTATAACAGAGATTTTTTGG + Intronic
1000097080 5:157980849-157980871 TAGTTGCAAGAGAGGTTGTATGG + Intergenic
1001084351 5:168690018-168690040 TAGTTACAATAGAGGTTTCTAGG + Intronic
1001499851 5:172222313-172222335 TAGGTCCTAAAGAGGTTGTGTGG - Intronic
1003285793 6:4732876-4732898 CAGGGACAACAGAGGTGGTGAGG + Intronic
1003657105 6:8022206-8022228 TTATTATAACACAGGTTGTGGGG + Intronic
1005089134 6:22037983-22038005 TAGTAACAATAGATATTGTGTGG - Intergenic
1005328687 6:24727471-24727493 TAGTTGAAACAGAGATTGTATGG - Intergenic
1005753770 6:28907370-28907392 GACTAACAACAGAGGTTCTGGGG - Intronic
1005889799 6:30127651-30127673 TAGTTACAAGAAAGGCTGGGAGG + Intergenic
1007293436 6:40803725-40803747 CAGCCACAACAGAGGTTGTGAGG + Intergenic
1008221955 6:48864916-48864938 TAGCTATAACAAAGATTGTGGGG + Intergenic
1009328655 6:62386227-62386249 TATTTAAAACAGAGATTATGTGG - Intergenic
1009478741 6:64129122-64129144 TAGTTGGAACAGAGGTTGTATGG + Intronic
1013740896 6:113283428-113283450 AAGTAACAACAGATGTTGTGAGG + Intergenic
1014164035 6:118203427-118203449 CACTTACAGAAGAGGTTGTGTGG - Intronic
1014495740 6:122119819-122119841 AAGTTATGACAGAAGTTGTGTGG + Intergenic
1015283511 6:131459090-131459112 TAGTTACAACAGAGAACATGGGG - Intergenic
1015416268 6:132952278-132952300 TTGTTGAAACAGATGTTGTGGGG - Intergenic
1015692964 6:135945663-135945685 TAGTTACAACAAAGATTGATGGG + Intronic
1015807608 6:137127115-137127137 TAGTTGCAAGAAAGGTTGGGAGG + Intergenic
1015969359 6:138728800-138728822 TAGTTACAGCAGAAGCTTTGAGG + Intergenic
1017054698 6:150426315-150426337 TTGTTGCAACAGAGACTGTGTGG + Intergenic
1019118997 6:169788402-169788424 TATTTAAAACAAATGTTGTGGGG - Intergenic
1021608593 7:22434028-22434050 TGGTTAGAACAGCTGTTGTGAGG - Intronic
1022169644 7:27812966-27812988 TAGTTGCAACAGAGACTGTGTGG + Intronic
1023200123 7:37687953-37687975 TCGTTGCAACAGAGATTGTTTGG - Intronic
1023303217 7:38795758-38795780 TAGTTCCCACAGGGTTTGTGTGG - Intronic
1023395779 7:39750708-39750730 TAGCTGCAACAGAGATTGTATGG + Intergenic
1024540136 7:50469349-50469371 TTGTTAAAACAGAGGTTGCTGGG + Intronic
1026254575 7:68699429-68699451 TTGTTAAAACACAGGTTGTTGGG + Intergenic
1026526734 7:71160078-71160100 TACATACAACAGAGGTGGTTGGG - Intronic
1027422951 7:78034989-78035011 TAGTTGAAACACAGGATGTGAGG + Intronic
1028781904 7:94746815-94746837 TGATTGCAGCAGAGGTTGTGAGG - Intergenic
1029026346 7:97420910-97420932 CAGTTTCTACAGAGCTTGTGGGG - Intergenic
1030260027 7:107554162-107554184 TAGTTGCAACAGAGACTGTATGG + Intronic
1030607854 7:111657294-111657316 TAGTTGCAACAAAGATTGTGTGG + Intergenic
1030713422 7:112781001-112781023 TAGTTAAAACAGAGATTGTATGG - Intronic
1031961607 7:127995087-127995109 TAGTTACGACAGAGGCTATATGG + Intronic
1033488514 7:141816279-141816301 TAGTTACATCAGAGTCTGTAAGG + Intergenic
1034647678 7:152663106-152663128 TAATTAGAGCAGAGGTTCTGAGG + Intronic
1036834903 8:12054445-12054467 TAGTAAAAACAGAGGCTATGAGG - Intergenic
1036856746 8:12301009-12301031 TAGTAAAAACAGAGGCTATGAGG - Intergenic
1037912775 8:22753914-22753936 TAGAATCAGCAGAGGTTGTGGGG - Intronic
1041792090 8:61708381-61708403 TATTTACAACACAGATTTTGAGG + Intronic
1042869162 8:73381759-73381781 TAGTTACAACAGAGAGTGTGAGG + Intergenic
1043520949 8:81044715-81044737 TGGTTACAGGAGAGGTTGTGAGG - Intronic
1044369934 8:91398617-91398639 TTGTTAGAACAAAGTTTGTGAGG - Intergenic
1046936742 8:119891952-119891974 TAGCTCCAACAGAGGCTGAGGGG - Intronic
1046937417 8:119898162-119898184 TAGTTGCAACAGAAATTGTGTGG + Intronic
1047315023 8:123724942-123724964 TACTTGCACCAGAGGTTCTGTGG + Intronic
1047625085 8:126648198-126648220 TAGTTGCAACGGAGATTGTCTGG - Intergenic
1047821246 8:128523518-128523540 TAGTTGCAACAGAGACTGTATGG + Intergenic
1047851818 8:128865439-128865461 TAGTGATAACGGAGGTTGGGGGG + Intergenic
1048305671 8:133282759-133282781 CAGTTGCAACAGAGGTCATGTGG + Intronic
1049839948 8:144764529-144764551 AAGTTGCAACAGAGGATGAGTGG - Intergenic
1050927293 9:11280465-11280487 TTTTTTCAAAAGAGGTTGTGGGG - Intergenic
1051135290 9:13913213-13913235 CAGTTGCAACAGAGACTGTGTGG - Intergenic
1051385266 9:16501111-16501133 TACTTACTACAGAGTTGGTGTGG + Intronic
1053362327 9:37497625-37497647 TAGTTGCAACAGAGGTTGTATGG + Intronic
1054921401 9:70546362-70546384 TTGTTACAACACAGGTTGCTGGG - Intronic
1054981639 9:71213120-71213142 TAGTTGCAACAGAGATTGTATGG - Intronic
1055253698 9:74339420-74339442 TTGTTGCAACAGAGATTGTATGG - Intergenic
1056441017 9:86621309-86621331 TTGTTGCAACAGAGATTGTGTGG + Intergenic
1058007368 9:99931618-99931640 TAGTTGCAACAGAGACTGTATGG + Intronic
1058127945 9:101217564-101217586 TAGTTTCAACAGAGATTGTATGG - Intronic
1058458350 9:105159153-105159175 TAGTTGCAACAGAGACCGTGTGG + Intergenic
1059522309 9:114955086-114955108 TAGTTGCAACAGAGGCTGTCTGG - Intergenic
1059557652 9:115297485-115297507 TAGTTACAATAGAGATTATGTGG - Intronic
1186343770 X:8670064-8670086 TAGTTCCAACACATTTTGTGGGG - Intronic
1186547922 X:10470242-10470264 TAGTTGCAACAGAGACTGTATGG - Intronic
1186842534 X:13498486-13498508 TAGTTGCCACAGAGACTGTGGGG + Intergenic
1186875401 X:13811639-13811661 TAGTTACAACAGACACTGAGTGG + Intronic
1187566071 X:20450866-20450888 TAGTTACAGTAGAGATTGTGTGG + Intergenic
1188303930 X:28539317-28539339 TAGTTTAAACAGAAGCTGTGCGG + Intergenic
1189182043 X:39013685-39013707 TAGTTGCAACAGAGACTGTAGGG + Intergenic
1189865239 X:45320891-45320913 TAGTTGCAACAGAGGCTCTTTGG - Intergenic
1193807694 X:86013955-86013977 TAACTGCAACAGAGGCTGTGTGG - Intronic
1195898899 X:109777090-109777112 TAGTCACAACAGACATTGTCTGG - Intergenic
1196991848 X:121338071-121338093 TAGTTACTACAGAGACTGTATGG + Intergenic
1197004763 X:121482100-121482122 TAGTTGCAACAGAGATTCTATGG + Intergenic
1197587006 X:128360814-128360836 TAGTTATAACAGAGACTGTATGG - Intergenic
1197687586 X:129458084-129458106 TAGTTGTGACAGAGATTGTGTGG - Intronic
1199889063 X:152056901-152056923 AAGTAACAACAGAGCTGGTGAGG + Intergenic
1200399939 X:156013531-156013553 TATTTATAACAGGGGCTGTGTGG + Intergenic
1200694825 Y:6349733-6349755 TAGGTATACCACAGGTTGTGGGG + Intergenic
1201040452 Y:9824977-9824999 TAGGTATACCACAGGTTGTGGGG - Intergenic
1201335163 Y:12872855-12872877 TTGTTGCAGCAGAGATTGTGAGG + Intergenic