ID: 1148166837

View in Genome Browser
Species Human (GRCh38)
Location 17:45489967-45489989
Sequence TGGGCTGTCCTCAGTACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148166837 Original CRISPR TGGGCTGTCCTCAGTACGGC AGG Intronic
901407420 1:9058464-9058486 GGGGCTGTCCTGAGCACAGCAGG + Intronic
901425867 1:9182254-9182276 TGGGCTGTCCCCAGACCGACGGG + Intergenic
905206231 1:36344241-36344263 TGGGCTTGCCACGGTACGGCCGG + Exonic
905530064 1:38670909-38670931 TGAGCTGACCTCAGTACCGAAGG - Intergenic
906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG + Intronic
912710423 1:111945746-111945768 TGGGCTGTCATCAGTGTTGCAGG + Intronic
915137973 1:153747057-153747079 TGGCCTTACCTGAGTACGGCAGG - Exonic
915287188 1:154860551-154860573 TGGGCTGTTCTCCGGAGGGCAGG - Intronic
915294712 1:154911895-154911917 CTGGCTGTCCTCAGGACAGCTGG - Intergenic
916074700 1:161193650-161193672 TGGGCAGTCCTCAGTGTTGCAGG + Exonic
921557705 1:216618881-216618903 TGGGCTGTTCTCAGTAGGCTTGG - Intronic
922089789 1:222384941-222384963 TGGGCTTGCCTCACTATGGCAGG + Intergenic
923054822 1:230418073-230418095 GGGGCTGTCCTGAGCACTGCAGG - Intronic
923819027 1:237415077-237415099 TGGGCTGTCCTGTGCATGGCAGG - Intronic
1064632315 10:17328989-17329011 TGGGCTGTTGTCAGTTGGGCTGG - Intronic
1065409812 10:25412337-25412359 TGGGCTGTCATCAGCACAGAAGG - Exonic
1065498692 10:26356366-26356388 TGGACTGTCCACAGGACAGCTGG - Intergenic
1070576472 10:77682608-77682630 AGGGCTGTCCTCAGTCTGGGTGG - Intergenic
1072090128 10:92119131-92119153 TGTGTTGTCCTCTGTAGGGCCGG + Intronic
1079084506 11:17435683-17435705 TGTACTGTCCTCTGTAGGGCTGG - Intronic
1083255319 11:61491836-61491858 GGGGCTGTCCACAGCCCGGCTGG + Intergenic
1091442425 12:521775-521797 TTGCCTGTCCTCAGTGAGGCCGG - Intronic
1096869436 12:54584134-54584156 GGGGATGTCCTCAGTACTGAAGG - Intronic
1099042758 12:77676396-77676418 TGGACTGTCCTTAGCACTGCTGG + Intergenic
1100778534 12:97999002-97999024 TGGGCTGTCTTAAGTACTGGGGG - Intergenic
1103007877 12:117436222-117436244 TAGGCTGTCCTCAGTTGGGGAGG - Intronic
1110789350 13:79569939-79569961 TGGGCACTCCTCATTACTGCTGG - Intergenic
1114266931 14:21078209-21078231 TGTGCTGGGCTCGGTACGGCAGG + Exonic
1118477122 14:66127995-66128017 TGGGCAGCCCTCAGTAAGACAGG + Intergenic
1121450460 14:94003967-94003989 TGTACTGTCTTCAGTAAGGCTGG + Intergenic
1122008725 14:98728167-98728189 TGGGCTGTCCTGTGTACTGTAGG - Intergenic
1202851377 14_GL000225v1_random:22665-22687 TGGGGTGTCTGCAGTATGGCCGG - Intergenic
1132543880 16:524278-524300 GGGGCTGTCCACAGTCCAGCTGG + Intergenic
1132925233 16:2425830-2425852 TGGTCTGTCCTTATTACAGCAGG - Intergenic
1133255492 16:4513613-4513635 CTGGCTGTCCTCAGTACAGGTGG - Intronic
1133404336 16:5510782-5510804 GGGGCTGTTCTGAGTACTGCAGG + Intergenic
1136719739 16:32310495-32310517 TGGGCGGTGCGCAGCACGGCGGG - Intergenic
1136838114 16:33516775-33516797 TGGGCGGTGCGCAGCACGGCGGG - Intergenic
1140698044 16:77554437-77554459 GGGGCTGTCCTGAGTATGGCAGG - Intergenic
1203006692 16_KI270728v1_random:207274-207296 TGGGCGGTGCGCAGCACGGCGGG + Intergenic
1203148285 16_KI270728v1_random:1817055-1817077 TGGGCGGTGCGCAGCACGGCGGG - Intergenic
1143885638 17:10062926-10062948 TGGGCTGCCCCAAGTACTGCAGG - Intronic
1144689679 17:17252457-17252479 TGGGCTGTCCTGGGCACTGCAGG + Intronic
1148166837 17:45489967-45489989 TGGGCTGTCCTCAGTACGGCAGG + Intronic
1148367650 17:47068814-47068836 TGGGGTGTCCTCAGGACGGCAGG - Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150398014 17:64836370-64836392 TGGGGTGTCCTCAGTACGGCAGG + Intergenic
1151571051 17:74925477-74925499 GGGCCTGTCCTCAGCTCGGCAGG + Intronic
1152450750 17:80378017-80378039 TGGGCTGTCCTGTGCACTGCAGG + Intronic
1158453302 18:57586118-57586140 TGGGCTTTCCTCAGCAGGGAGGG + Intronic
1161144379 19:2668829-2668851 GGGGCTGTGCTGAGTACCGCAGG + Intronic
1164903005 19:31944101-31944123 TGGGCTGAACTCAGATCGGCAGG - Intergenic
1165314967 19:35049236-35049258 AGGCCTGTCCTCATTGCGGCAGG - Intronic
927233529 2:20848976-20848998 TGGGCTGAACTCAGTGGGGCTGG + Intergenic
936964032 2:118108931-118108953 TGGGCTGTCTCCAGTAACGCAGG - Exonic
941991603 2:171562435-171562457 TGGCCTGTCCTTAGAATGGCTGG - Intergenic
947953869 2:234171062-234171084 TGCGCTGTTCTCAGAAAGGCGGG + Intergenic
948240583 2:236429730-236429752 TGGGCTGTGCTCACTGTGGCAGG + Intronic
948865028 2:240770876-240770898 TGGGCTGTACCCAGGAGGGCAGG + Intronic
1170611386 20:17916513-17916535 TGGGCTGTTCTCAGGATGGCTGG - Intergenic
1172628887 20:36365215-36365237 TGGCCTGTGCCCAGCACGGCAGG - Intronic
1173522682 20:43711380-43711402 TGGGCTGTCCTGGGTAAGGCAGG - Intronic
1173552971 20:43946237-43946259 TGGGCTGTCCTCTGGAGAGCAGG + Intronic
1174388378 20:50200691-50200713 TGGGCTGGCCCCAGGAAGGCTGG - Intergenic
1175688377 20:61047699-61047721 TGGGCTGTTCCCAGTGTGGCTGG - Intergenic
1176155679 20:63619199-63619221 TGGGCTGTCCTTGGCACAGCTGG - Intronic
1178790144 21:35692541-35692563 TGGGCTGTCCTCACTTTGCCTGG - Intronic
1179164634 21:38925859-38925881 GGGGCTGTCCCCAGTGCTGCAGG - Intergenic
1180043701 21:45293207-45293229 TGGGCAGTTCTCAGCACAGCTGG + Intergenic
1181025190 22:20123755-20123777 TAGGTTGTCCTGAGTATGGCTGG + Intronic
1183508168 22:38220729-38220751 TGGGCTGTCCTTGGTAGGCCAGG + Exonic
950435386 3:12976291-12976313 TGGGGTGTGCTCAGCAGGGCTGG - Intronic
953790361 3:45942757-45942779 TGGGCTGCCCTCTGTACTCCTGG - Intronic
955998955 3:64708442-64708464 TAGTCTGTCCTCAGTAAGGGAGG - Intergenic
964591004 3:158361531-158361553 TGGGCTGTCCACAGTGGGGGAGG - Intronic
969584626 4:8084693-8084715 TGGGGTCTCCTCAGCACGGATGG + Intronic
977212413 4:94234510-94234532 TGGACTGTCCTTAGTACTGCAGG - Intronic
981735848 4:147949531-147949553 TGGGCTGTCCTATGTACTGCAGG - Intronic
984983539 4:185305214-185305236 GGGGCTGTCCTGTGTACTGCAGG - Intronic
986091317 5:4511400-4511422 TGGTCTGTCCTCATGGCGGCAGG - Intergenic
992979253 5:82150696-82150718 TGGCCTTTCCTCAGTACAGTAGG + Intronic
994107296 5:95961655-95961677 TGGGCTGTCGTGCGGACGGCTGG - Exonic
996901222 5:128543558-128543580 TGGGATGGCCTCATTACTGCTGG - Intronic
1003911943 6:10751039-10751061 TGTGCTGTCCTTTGTAGGGCAGG + Intronic
1004309802 6:14535165-14535187 AGGGCTGTCTGCAGAACGGCTGG - Intergenic
1004745096 6:18501680-18501702 TGGGCTGTCCCTAGTAAGGAAGG + Intergenic
1014709124 6:124785775-124785797 CGGACTGGCCTCAGTACTGCTGG + Intronic
1016874004 6:148846954-148846976 TGGGCTCTCCTGAGTGAGGCAGG + Intronic
1018648015 6:165965821-165965843 TGGGCTGTCTTCAGTGCTGTTGG - Intronic
1018690729 6:166342350-166342372 CGGCCGGTCCTCAGTGCGGCCGG + Intronic
1021021739 7:15608609-15608631 TCTGCTGTCATCAGTACGCCAGG + Intergenic
1022049889 7:26656183-26656205 TTGGCAATCCTCAGTACAGCTGG + Intergenic
1022467376 7:30660855-30660877 TGGCCTGTCCTCAGTCGGGCTGG - Intronic
1023512890 7:40971752-40971774 TGGGTTGTCGTCAGTACCACAGG + Intergenic
1030842684 7:114375589-114375611 TGGGCAGACCTCAGTAAGGAAGG + Intronic
1032708423 7:134442052-134442074 TGGGCTGTGATCAGGACAGCAGG - Intergenic
1034532763 7:151707037-151707059 AGGGCTGAGCTCAGTAAGGCTGG - Intronic
1037391276 8:18394258-18394280 TGGAATGTCATCAGTAAGGCAGG + Intronic
1039465914 8:37784791-37784813 TGTGCTGTCCCCAGCAGGGCTGG + Intronic
1040604050 8:48912224-48912246 AGGGCTGTTCTCAGTGGGGCTGG - Intergenic
1043629255 8:82308111-82308133 TAGCCTGTCCTCAGTAGGGAGGG - Intergenic
1045703675 8:104896177-104896199 TGGGCTGTGCTCAAAACAGCAGG + Intronic
1047311115 8:123692936-123692958 TGGGCTGTCCTGTGCACTGCAGG + Intronic
1047364468 8:124199610-124199632 TGGGCTGTGCTCAGAACTTCAGG + Intergenic
1049420772 8:142515581-142515603 TGGGCTGGCCTGAGGCCGGCTGG - Intronic
1049431360 8:142566779-142566801 TGGGCTGAGATCAGTACGGGTGG + Intergenic
1053851168 9:42289518-42289540 TGGGGTGTGTTCAGTACGCCAGG + Intergenic
1056852436 9:90095793-90095815 TGGGCTGGCCTCAGCAAGGGTGG - Intergenic
1062423232 9:136494053-136494075 GGGGCTGTCCCCAGGATGGCTGG + Intergenic
1185781132 X:2847868-2847890 TGGGGTGTCCTGTGTACTGCAGG + Intronic
1195858069 X:109352055-109352077 TGTGCTGCACTCAGCACGGCTGG + Intergenic