ID: 1148172271

View in Genome Browser
Species Human (GRCh38)
Location 17:45532245-45532267
Sequence CCCCAGTGCTGTCTTCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148172271_1148172275 -7 Left 1148172271 17:45532245-45532267 CCTGCGGGAAGACAGCACTGGGG No data
Right 1148172275 17:45532261-45532283 ACTGGGGAGTGATGGCTAATGGG No data
1148172271_1148172279 30 Left 1148172271 17:45532245-45532267 CCTGCGGGAAGACAGCACTGGGG No data
Right 1148172279 17:45532298-45532320 TTGGGATGATGAAAATGTTCTGG No data
1148172271_1148172277 12 Left 1148172271 17:45532245-45532267 CCTGCGGGAAGACAGCACTGGGG No data
Right 1148172277 17:45532280-45532302 TGGGTACCATGTTTCTTTTTGGG No data
1148172271_1148172274 -8 Left 1148172271 17:45532245-45532267 CCTGCGGGAAGACAGCACTGGGG No data
Right 1148172274 17:45532260-45532282 CACTGGGGAGTGATGGCTAATGG No data
1148172271_1148172276 11 Left 1148172271 17:45532245-45532267 CCTGCGGGAAGACAGCACTGGGG No data
Right 1148172276 17:45532279-45532301 ATGGGTACCATGTTTCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148172271 Original CRISPR CCCCAGTGCTGTCTTCCCGC AGG (reversed) Intergenic