ID: 1148178372

View in Genome Browser
Species Human (GRCh38)
Location 17:45586117-45586139
Sequence TCATCAGGCGGAACTCGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148178372_1148178374 -10 Left 1148178372 17:45586117-45586139 CCTCTACGAGTTCCGCCTGATGA No data
Right 1148178374 17:45586130-45586152 CGCCTGATGATGACCTTCAGCGG No data
1148178372_1148178376 2 Left 1148178372 17:45586117-45586139 CCTCTACGAGTTCCGCCTGATGA No data
Right 1148178376 17:45586142-45586164 ACCTTCAGCGGCCTGAACCGCGG No data
1148178372_1148178380 30 Left 1148178372 17:45586117-45586139 CCTCTACGAGTTCCGCCTGATGA No data
Right 1148178380 17:45586170-45586192 CATATGCCCGCTGCAGCTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148178372 Original CRISPR TCATCAGGCGGAACTCGTAG AGG (reversed) Intergenic
No off target data available for this crispr