ID: 1148180583

View in Genome Browser
Species Human (GRCh38)
Location 17:45601996-45602018
Sequence AAAAGTACAGTTGGCAGGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148180583_1148180588 26 Left 1148180583 17:45601996-45602018 CCGATCCTGCCAACTGTACTTTT No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148180583 Original CRISPR AAAAGTACAGTTGGCAGGAT CGG (reversed) Intergenic
No off target data available for this crispr