ID: 1148180584

View in Genome Browser
Species Human (GRCh38)
Location 17:45602001-45602023
Sequence GGGCAAAAAGTACAGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148180584_1148180590 28 Left 1148180584 17:45602001-45602023 CCTGCCAACTGTACTTTTTGCCC No data
Right 1148180590 17:45602052-45602074 ACAACTGCACCTGCGGAAAGAGG No data
1148180584_1148180588 21 Left 1148180584 17:45602001-45602023 CCTGCCAACTGTACTTTTTGCCC No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148180584 Original CRISPR GGGCAAAAAGTACAGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr