ID: 1148180586

View in Genome Browser
Species Human (GRCh38)
Location 17:45602021-45602043
Sequence ACACTGAATAATAATTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148180586_1148180594 22 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180594 17:45602066-45602088 GGAAAGAGGTTGAGCGTGGTGGG No data
1148180586_1148180595 30 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180595 17:45602074-45602096 GTTGAGCGTGGTGGGCCGCTTGG No data
1148180586_1148180592 18 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180592 17:45602062-45602084 CTGCGGAAAGAGGTTGAGCGTGG No data
1148180586_1148180588 1 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data
1148180586_1148180593 21 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180593 17:45602065-45602087 CGGAAAGAGGTTGAGCGTGGTGG No data
1148180586_1148180590 8 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180590 17:45602052-45602074 ACAACTGCACCTGCGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148180586 Original CRISPR ACACTGAATAATAATTCTCT GGG (reversed) Intergenic
No off target data available for this crispr