ID: 1148180588

View in Genome Browser
Species Human (GRCh38)
Location 17:45602045-45602067
Sequence TCCTGAGACAACTGCACCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148180583_1148180588 26 Left 1148180583 17:45601996-45602018 CCGATCCTGCCAACTGTACTTTT No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data
1148180585_1148180588 17 Left 1148180585 17:45602005-45602027 CCAACTGTACTTTTTGCCCAGAG No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data
1148180582_1148180588 27 Left 1148180582 17:45601995-45602017 CCCGATCCTGCCAACTGTACTTT No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data
1148180584_1148180588 21 Left 1148180584 17:45602001-45602023 CCTGCCAACTGTACTTTTTGCCC No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data
1148180586_1148180588 1 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data
1148180587_1148180588 0 Left 1148180587 17:45602022-45602044 CCAGAGAATTATTATTCAGTGTG No data
Right 1148180588 17:45602045-45602067 TCCTGAGACAACTGCACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148180588 Original CRISPR TCCTGAGACAACTGCACCTG CGG Intergenic
No off target data available for this crispr