ID: 1148180589

View in Genome Browser
Species Human (GRCh38)
Location 17:45602046-45602068
Sequence TCCGCAGGTGCAGTTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148180589_1148180600 30 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180600 17:45602099-45602121 CGGTACGTGTCCCCGCTGCCCGG No data
1148180589_1148180594 -3 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180594 17:45602066-45602088 GGAAAGAGGTTGAGCGTGGTGGG No data
1148180589_1148180595 5 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180595 17:45602074-45602096 GTTGAGCGTGGTGGGCCGCTTGG No data
1148180589_1148180596 6 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180596 17:45602075-45602097 TTGAGCGTGGTGGGCCGCTTGGG No data
1148180589_1148180592 -7 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180592 17:45602062-45602084 CTGCGGAAAGAGGTTGAGCGTGG No data
1148180589_1148180593 -4 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180593 17:45602065-45602087 CGGAAAGAGGTTGAGCGTGGTGG No data
1148180589_1148180597 10 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180597 17:45602079-45602101 GCGTGGTGGGCCGCTTGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148180589 Original CRISPR TCCGCAGGTGCAGTTGTCTC AGG (reversed) Intergenic
No off target data available for this crispr