ID: 1148180590

View in Genome Browser
Species Human (GRCh38)
Location 17:45602052-45602074
Sequence ACAACTGCACCTGCGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148180587_1148180590 7 Left 1148180587 17:45602022-45602044 CCAGAGAATTATTATTCAGTGTG No data
Right 1148180590 17:45602052-45602074 ACAACTGCACCTGCGGAAAGAGG No data
1148180585_1148180590 24 Left 1148180585 17:45602005-45602027 CCAACTGTACTTTTTGCCCAGAG No data
Right 1148180590 17:45602052-45602074 ACAACTGCACCTGCGGAAAGAGG No data
1148180584_1148180590 28 Left 1148180584 17:45602001-45602023 CCTGCCAACTGTACTTTTTGCCC No data
Right 1148180590 17:45602052-45602074 ACAACTGCACCTGCGGAAAGAGG No data
1148180586_1148180590 8 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180590 17:45602052-45602074 ACAACTGCACCTGCGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148180590 Original CRISPR ACAACTGCACCTGCGGAAAG AGG Intergenic
No off target data available for this crispr