ID: 1148180593

View in Genome Browser
Species Human (GRCh38)
Location 17:45602065-45602087
Sequence CGGAAAGAGGTTGAGCGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148180587_1148180593 20 Left 1148180587 17:45602022-45602044 CCAGAGAATTATTATTCAGTGTG No data
Right 1148180593 17:45602065-45602087 CGGAAAGAGGTTGAGCGTGGTGG No data
1148180586_1148180593 21 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180593 17:45602065-45602087 CGGAAAGAGGTTGAGCGTGGTGG No data
1148180589_1148180593 -4 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180593 17:45602065-45602087 CGGAAAGAGGTTGAGCGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148180593 Original CRISPR CGGAAAGAGGTTGAGCGTGG TGG Intergenic
No off target data available for this crispr