ID: 1148180595

View in Genome Browser
Species Human (GRCh38)
Location 17:45602074-45602096
Sequence GTTGAGCGTGGTGGGCCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148180591_1148180595 -10 Left 1148180591 17:45602061-45602083 CCTGCGGAAAGAGGTTGAGCGTG No data
Right 1148180595 17:45602074-45602096 GTTGAGCGTGGTGGGCCGCTTGG No data
1148180587_1148180595 29 Left 1148180587 17:45602022-45602044 CCAGAGAATTATTATTCAGTGTG No data
Right 1148180595 17:45602074-45602096 GTTGAGCGTGGTGGGCCGCTTGG No data
1148180586_1148180595 30 Left 1148180586 17:45602021-45602043 CCCAGAGAATTATTATTCAGTGT No data
Right 1148180595 17:45602074-45602096 GTTGAGCGTGGTGGGCCGCTTGG No data
1148180589_1148180595 5 Left 1148180589 17:45602046-45602068 CCTGAGACAACTGCACCTGCGGA No data
Right 1148180595 17:45602074-45602096 GTTGAGCGTGGTGGGCCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148180595 Original CRISPR GTTGAGCGTGGTGGGCCGCT TGG Intergenic
No off target data available for this crispr