ID: 1148180596 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:45602075-45602097 |
| Sequence | TTGAGCGTGGTGGGCCGCTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148180589_1148180596 | 6 | Left | 1148180589 | 17:45602046-45602068 | CCTGAGACAACTGCACCTGCGGA | No data | ||
| Right | 1148180596 | 17:45602075-45602097 | TTGAGCGTGGTGGGCCGCTTGGG | No data | ||||
| 1148180591_1148180596 | -9 | Left | 1148180591 | 17:45602061-45602083 | CCTGCGGAAAGAGGTTGAGCGTG | No data | ||
| Right | 1148180596 | 17:45602075-45602097 | TTGAGCGTGGTGGGCCGCTTGGG | No data | ||||
| 1148180587_1148180596 | 30 | Left | 1148180587 | 17:45602022-45602044 | CCAGAGAATTATTATTCAGTGTG | No data | ||
| Right | 1148180596 | 17:45602075-45602097 | TTGAGCGTGGTGGGCCGCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148180596 | Original CRISPR | TTGAGCGTGGTGGGCCGCTT GGG | Intergenic | ||
| No off target data available for this crispr | |||||