ID: 1148183941

View in Genome Browser
Species Human (GRCh38)
Location 17:45627796-45627818
Sequence TAGAGTATACGGGAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148183941_1148183949 2 Left 1148183941 17:45627796-45627818 CCCCCATCCTCCCGTATACTCTA No data
Right 1148183949 17:45627821-45627843 TCAGTGGTCCCCAACCTTTTTGG 0: 83
1: 551
2: 979
3: 1392
4: 1517
1148183941_1148183950 9 Left 1148183941 17:45627796-45627818 CCCCCATCCTCCCGTATACTCTA No data
Right 1148183950 17:45627828-45627850 TCCCCAACCTTTTTGGCACCAGG 0: 893
1: 1635
2: 1478
3: 850
4: 574
1148183941_1148183952 10 Left 1148183941 17:45627796-45627818 CCCCCATCCTCCCGTATACTCTA No data
Right 1148183952 17:45627829-45627851 CCCCAACCTTTTTGGCACCAGGG 0: 887
1: 1622
2: 1379
3: 833
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148183941 Original CRISPR TAGAGTATACGGGAGGATGG GGG (reversed) Intergenic
No off target data available for this crispr