ID: 1148186999

View in Genome Browser
Species Human (GRCh38)
Location 17:45651363-45651385
Sequence CCTCAAGAACTCAAGGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148186999_1148187005 11 Left 1148186999 17:45651363-45651385 CCCTAGACCTTGAGTTCTTGAGG No data
Right 1148187005 17:45651397-45651419 CAAGTCTCAGCTTTCTCTGCAGG No data
1148186999_1148187006 27 Left 1148186999 17:45651363-45651385 CCCTAGACCTTGAGTTCTTGAGG No data
Right 1148187006 17:45651413-45651435 CTGCAGGACCGAGCACATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148186999 Original CRISPR CCTCAAGAACTCAAGGTCTA GGG (reversed) Intergenic
No off target data available for this crispr