ID: 1148188716

View in Genome Browser
Species Human (GRCh38)
Location 17:45663824-45663846
Sequence TCCCCATTGCTCCTACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148188716_1148188722 29 Left 1148188716 17:45663824-45663846 CCTGTCTGTAGGAGCAATGGGGA No data
Right 1148188722 17:45663876-45663898 ACCTTTAGCAACAAGGAAATGGG No data
1148188716_1148188717 -9 Left 1148188716 17:45663824-45663846 CCTGTCTGTAGGAGCAATGGGGA No data
Right 1148188717 17:45663838-45663860 CAATGGGGATGCAAACAGTCAGG No data
1148188716_1148188721 28 Left 1148188716 17:45663824-45663846 CCTGTCTGTAGGAGCAATGGGGA No data
Right 1148188721 17:45663875-45663897 GACCTTTAGCAACAAGGAAATGG No data
1148188716_1148188718 22 Left 1148188716 17:45663824-45663846 CCTGTCTGTAGGAGCAATGGGGA No data
Right 1148188718 17:45663869-45663891 CTACCCGACCTTTAGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148188716 Original CRISPR TCCCCATTGCTCCTACAGAC AGG (reversed) Intergenic
No off target data available for this crispr