ID: 1148190880

View in Genome Browser
Species Human (GRCh38)
Location 17:45677897-45677919
Sequence GTGCAAACCCAGAATAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148190880_1148190887 4 Left 1148190880 17:45677897-45677919 CCCAGCTTATTCTGGGTTTGCAC No data
Right 1148190887 17:45677924-45677946 GGGGCTGACTCATAGGGAGCAGG No data
1148190880_1148190886 -2 Left 1148190880 17:45677897-45677919 CCCAGCTTATTCTGGGTTTGCAC No data
Right 1148190886 17:45677918-45677940 ACGTGTGGGGCTGACTCATAGGG No data
1148190880_1148190885 -3 Left 1148190880 17:45677897-45677919 CCCAGCTTATTCTGGGTTTGCAC No data
Right 1148190885 17:45677917-45677939 CACGTGTGGGGCTGACTCATAGG No data
1148190880_1148190889 30 Left 1148190880 17:45677897-45677919 CCCAGCTTATTCTGGGTTTGCAC No data
Right 1148190889 17:45677950-45677972 GCCCATCCTCTGGAGTGAGAAGG No data
1148190880_1148190888 20 Left 1148190880 17:45677897-45677919 CCCAGCTTATTCTGGGTTTGCAC No data
Right 1148190888 17:45677940-45677962 GAGCAGGAGAGCCCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148190880 Original CRISPR GTGCAAACCCAGAATAAGCT GGG (reversed) Intergenic
No off target data available for this crispr