ID: 1148193458

View in Genome Browser
Species Human (GRCh38)
Location 17:45696705-45696727
Sequence CAGGTGAGAGTACCTGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148193458_1148193465 27 Left 1148193458 17:45696705-45696727 CCTATGCCAGGTACTCTCACCTG No data
Right 1148193465 17:45696755-45696777 GTACCCATTAGAATTGGGTTTGG No data
1148193458_1148193461 0 Left 1148193458 17:45696705-45696727 CCTATGCCAGGTACTCTCACCTG No data
Right 1148193461 17:45696728-45696750 TGTTAGCCTGTGAGTGATTTAGG No data
1148193458_1148193464 22 Left 1148193458 17:45696705-45696727 CCTATGCCAGGTACTCTCACCTG No data
Right 1148193464 17:45696750-45696772 GCAGTGTACCCATTAGAATTGGG No data
1148193458_1148193463 21 Left 1148193458 17:45696705-45696727 CCTATGCCAGGTACTCTCACCTG No data
Right 1148193463 17:45696749-45696771 GGCAGTGTACCCATTAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148193458 Original CRISPR CAGGTGAGAGTACCTGGCAT AGG (reversed) Intergenic
No off target data available for this crispr