ID: 1148194266

View in Genome Browser
Species Human (GRCh38)
Location 17:45701909-45701931
Sequence AAGAGTGGGCAGAGTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148194255_1148194266 22 Left 1148194255 17:45701864-45701886 CCCTAGAAGACGTCCTGGGTGAG No data
Right 1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG No data
1148194258_1148194266 9 Left 1148194258 17:45701877-45701899 CCTGGGTGAGGAAAGATTCCAAG No data
Right 1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG No data
1148194256_1148194266 21 Left 1148194256 17:45701865-45701887 CCTAGAAGACGTCCTGGGTGAGG No data
Right 1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG No data
1148194262_1148194266 -9 Left 1148194262 17:45701895-45701917 CCAAGTGGGCCTCAAAGAGTGGG No data
Right 1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148194266 Original CRISPR AAGAGTGGGCAGAGTGTGGA AGG Intergenic
No off target data available for this crispr