ID: 1148195329

View in Genome Browser
Species Human (GRCh38)
Location 17:45708934-45708956
Sequence CTGTGCCCTTGCCTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148195329_1148195334 22 Left 1148195329 17:45708934-45708956 CCAGCCTCAAGGCAAGGGCACAG No data
Right 1148195334 17:45708979-45709001 CCTGCTTTGTCTGCTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148195329 Original CRISPR CTGTGCCCTTGCCTTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr