ID: 1148195507

View in Genome Browser
Species Human (GRCh38)
Location 17:45709997-45710019
Sequence GCCTTGATCAGGGGTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148195507_1148195511 -7 Left 1148195507 17:45709997-45710019 CCACTGAGACCCCTGATCAAGGC No data
Right 1148195511 17:45710013-45710035 TCAAGGCCATTTCTACCTCTAGG No data
1148195507_1148195512 -4 Left 1148195507 17:45709997-45710019 CCACTGAGACCCCTGATCAAGGC No data
Right 1148195512 17:45710016-45710038 AGGCCATTTCTACCTCTAGGTGG No data
1148195507_1148195519 23 Left 1148195507 17:45709997-45710019 CCACTGAGACCCCTGATCAAGGC No data
Right 1148195519 17:45710043-45710065 GCCAGGCTCAGGGGCACTGCTGG No data
1148195507_1148195517 13 Left 1148195507 17:45709997-45710019 CCACTGAGACCCCTGATCAAGGC No data
Right 1148195517 17:45710033-45710055 AGGTGGACAAGCCAGGCTCAGGG No data
1148195507_1148195518 14 Left 1148195507 17:45709997-45710019 CCACTGAGACCCCTGATCAAGGC No data
Right 1148195518 17:45710034-45710056 GGTGGACAAGCCAGGCTCAGGGG No data
1148195507_1148195516 12 Left 1148195507 17:45709997-45710019 CCACTGAGACCCCTGATCAAGGC No data
Right 1148195516 17:45710032-45710054 TAGGTGGACAAGCCAGGCTCAGG No data
1148195507_1148195514 6 Left 1148195507 17:45709997-45710019 CCACTGAGACCCCTGATCAAGGC No data
Right 1148195514 17:45710026-45710048 TACCTCTAGGTGGACAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148195507 Original CRISPR GCCTTGATCAGGGGTCTCAG TGG (reversed) Intergenic