ID: 1148196530

View in Genome Browser
Species Human (GRCh38)
Location 17:45717254-45717276
Sequence GTAACTGTGTTACCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148196530_1148196534 14 Left 1148196530 17:45717254-45717276 CCTGGAACAGGTAACACAGTTAC No data
Right 1148196534 17:45717291-45717313 CTTTGTGGGTTTTTTTTTTTTGG No data
1148196530_1148196532 0 Left 1148196530 17:45717254-45717276 CCTGGAACAGGTAACACAGTTAC No data
Right 1148196532 17:45717277-45717299 ACACCATGCATATACTTTGTGGG No data
1148196530_1148196531 -1 Left 1148196530 17:45717254-45717276 CCTGGAACAGGTAACACAGTTAC No data
Right 1148196531 17:45717276-45717298 CACACCATGCATATACTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148196530 Original CRISPR GTAACTGTGTTACCTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr